L’impacte de les pluges sobre la microbiota de la zona hiperàrida del Desert d’Atacama

Ecologia microbiana: El Desert d’Atacama és l’indret més àrid de la terra. Per minses que puguin semblar en termes absoluts, els episodis de pluja registrats en els darrers tres anys a la zona central d’Atacama no tenen precedents. Com a resultat d’aquestes pluges s’han formats llacs hipersalins que, en alguns casos, han perdurat durant mesos. Aquest ambient inusitat impulsà el grup de recerca d’Armando Javier Azúa Bustos i de Alberto G. Fairén, del Centro de Astrobiología del CSIC-INTA, de Madrid, a fer-hi un seguiment de les comunitats microbianes, com si es tractés d’un model de Mart a la Terra. En un article a Scientific Reports ofereixen una anàlisi sistemàtica de l’evolució de les llacunes formades especialment enfocat a les comunitats microbianes locals. Cal recordar que algunes d’aquestes zones haurien estat completament àrides en els darrers milions d’anys. L’entrada sobtada i massiva d’aigua, segons mostren Azua-Bustos et al. perjudicà la majoria d’espècies microbianes que viuen en la superfície del sòl. Es tracta de microorganismes xeròfils, adaptats a sobreviure amb quantitats molt magres d’aigua, i que pogueren resistir el xoc osmòtic provocat per la pluja. Així doncs, en aquestes llacunes hipersalines tan sols un nombre reduït de bacteris hi són metabòlicament actius. Azua-Bustos et al. descriuen entre aquests bacteris, una espècie prèviament desconeguda, Halomonas yungayensis. És interessant, doncs, constatar que la pluja sobtada i voluminosa té un efecte depressor en la diversitat de les comunitats microbianes de sòls de regions hiperàrides. Azua-Bustos et al. utilitzen aquest estudi per reflexionar sobre les condicions de Mart, “un planeta hiperàrid que experimentà inundacions catastròfiques en temps antics“.

El 7 de juny del 2017 va ploure a la zona de Yungay. Azua-Bustos et al. visitaren el 8 de juliol del 2017 (A). L’11 de novembre del 2017 hi feren una altra visita als llacs grans (B), mitjà (C) i petit (D)

Yungay, Atacama

Aquesta recerca fou concebuda per Azua-Bustos i per Fairén, que foren els qui dirigiren l’estudi i redactaren l’article. Cal recordar que Azua-Bustos també és membre del Instituto de Ciencias Biomédicas de la Facultad de Ciencias de la Salud de la Universidad Autónoma de Chile. L’estudi in situ i la recollida de mostres la va fer Carlos González-Silva, de la Facultad de Ciencias de la Universidad de Tarapacá, de Arica. La preparació de mostres i l’obtenció de electromicrografies de transmissió anaren a càrrec de Jacek Wierzchos i Carmen Ascaso, del Museo Nacional de Ciencias Naturales de Madrid. El cultiu de les mostres i l’aïllament de microorganismes els feren Azua-Bustos i Laura García Descalzo, que també és membre del Departamento de Planetología y Habitabilidad del Centro de Astrobiología. Azua-Bustos realitzà el genotipat d’elements repetitius ERIC1, l’amplificació del gen del ARNr 16S, i l’anàlisi filogenètica. Les anàlisis de de seqüenciació les realitzà Miguel Ángel Fernández Martínez, el Departamento de Evolución Molecular del Centro de Astrobiología. L’extracció de lípids, fraccionament i anàlisi per cromatografia de gasos i espectrometria de masses la feren Daniel Carrizo i Laura Sánchez García, del Departamento de Evolución Molecular. També del mateix Departament és Miriam García Villadangos, que realitzà l’anàlisi de cromatografia iònica. María Paz Martín Redondo, del Departamento de Planetología y Habitabilidad, realitzà l’espectrometria de masses de plasma acoblat inductivament. Víctor Parro, del Departamento de Evolución Molecular, féu el serotipat per microarray. Mª Teresa Fernández Sampedro, del Departamento de Planetología y Habitabilidad, realitzà l’anàlisi de difracció de raigs X.

Aquesta recerca es va fer en el marc del projecte “icyMARS”, finançant pel Consell Europeu de Recerca. Fairén i Pardo també reben finançament del Ministeri d’Educació d’Espanya i del programa FEDER pel seu projecte de detecció de biomolècules en l’exploració planetària. També tenen paraules d’agraïment per a Virginia Souza-Egipsy en la interpretació de les electrografies.

El Desert d’Atacama, en el nord de Xile, situat entre la Serralada dels Andes a l’est, i la Serralada Litoral a l’oest, ocupa uns 105.000 km2. En la zona central trobem un clima hiperàrid, que ha suportat condicions d’aridesa durant els darrers 150 milions d’anys, i condicions d’hiperaridesa durant els darrers 15 milions. En aquesta zona la precipitació anual mitjana es troba per sota dels 4 mm/m2. No és estrany que hom hagi proposat la regió de Yungay, dins d’aquesta zona hiperàrida, com un bon model per als estudis de Mart.

L’eixutesa extrema, l’elevat contingut salí del sòl (particularment enriquit en nitrats, sulfats i perclorats) i l’extremada pobresa en matèria orgànica fan de la regió de Yungay un indret força inhòspit. Tanmateix, és un indret amb vida microbiana. Bacteris, arqueons i eucarionts de Yungay comparteixen una elevada tolerància a la sequedat, a l’elevada salinitat i a la radiació ultraviolada.

Imatges del Desert d’Atacama durant el primer terç del mes de juny del 2017. L’aridesa de la regió s’explica pel fet que la Serralada Litoral constitueix una barrera per als núvols que arriben del Pacífic: no debades, el vessant marítim de la Serralada Litoral és un dels indrets amb més precipitacions anuals del món. Entre el 5 i el 7 de juny del 2017, núvols de pluja creuaren no obstant la serra i precipitaren a Atacama, bé en forma de pluja, en les zones baixes, o de neu

Si bé en la perifèria del Desert d’Atacama no són del tot infreqüents les precipitacions de pluja o de neu durant “l’hivern altiplànic”, entre el desembre i el març, degut a corrents d’aire humit de llevant que creuen els Andes, la zona central d’Atacama no és exposada a aquestes situacions. En els darrers quatre anys, no obstant s’han registrat tres pluges remarcables per l’entrada de vents de ponents:
– la del 25 de març del 2015.
– la del 9 d’agost del 2015.
– la del 7 de juny del 2017.

Aquests tres episodis de pluges, juntament amb altres de menor quantia, han fet que la precipitació anual per al període 2015-2017 hagi estat de fins a 40 mm/m2, és a dir deu vegades superior de la mitjana climàtica. D’acord amb els registres paleometeorològics, aquesta situació no té precedents en els darrers 500 anys.

Com a resultat d’aquests episodis de pluja es formaren llacunes a la regió de Yungay per primera vegada en la història documentada. El novembre del 2017 encara sobrevivien tres llacunes a la regió de Yungay cinc mesos després de la pluja del 7 de juny. Aquestes tres llacunes foren l’objecte de l’estudi d’Azua-Bustos et al.

El mostreig de tres llacunes hipersalines

L’11 de novembre del 2017 es procedí una presa de mostres en tres llacunes de la regió hiperàrida de Yungay. Les mostres les prengué González-Silva amb guants estèrils, abocant-les a tubs falcon de 50 ml.

La cromatografia iònica permeté la quantificació d’anions d’aquestes mostres. Per espectrometria de masses ICP-MS es feren determinacions d’elements (Mn, Cu, Co, Cd, Ba, Na, Mg, K, Ca, Fe, Ni, Zn, As).

La composició mineralògica de les aigües fou estudiada per difracció de raigs X (XRD).

El contingut lipídic de les mostres fou analitzat per cromatografia gasos acoblada a espectrometria de masses (GC-MS), diferenciant entre les fraccions apolar, acídica i polar.

Per a l’extracció d’ADN, les mostres eren centrifugades i als pellets resultants se’ls aplicava el DNeasy PowerSoil Kit.

Dels extractes d’ADN es feien amplificacions de la regió V3-V4 del gen rDNA 16S amb els encebadors 5′-ACACTGACGACATGGTTCTACACCTACGGGNGGCWGCAG-3′ i 5′-TACGGTAGCAGAGACTTGGTCTGACTACHVGGGTATCTAATCC-3′ en els primers cicles. Els amplicons obtinguts eren validats i quantificats, i seguidament seqüenciats.

Alíquotes d’1 mL de les mostres foren incubades aeròbicament a 25°C en agar amb diferents medis, i se’n seguí el creixement durant 2 setmanes. De les colònies obtingudes es féu una extracció d’ADN i una seqüenciació del gen rDNA 16S.

Extractes d’ADN de les colònies obtingudes també foren analitzats amb encebadors ERIC (5′AAGTAAGTGACTGGGGTGAGCG3′ i 5′-ATGTAAGCTCCTGGGGATTCAC-3′), que amplifiquen seqüències repetitives intergèniques de consens entre enterobacteris. Si el gen rDNA 16S permet una classificació taxonòmica a l’engròs, la tècnica de PCR-ERIC, sense necessitat de seqüenciació, ajuda a afinar a nivell d’espècie.

Mostres dels cultius obtinguts de la llacuna gran i de la petita foren destinades a la microscòpia electrònica de transmissió. Com a tècnica de tinció s’utilitzà la negativa de fosfotungstat de sodi. Les electrografies permetien caracteritzar els diferents morfotips de cada cultiu bacterià: mida, forma, presència o absència de flagels i la seu nombre i inserció, presència o absència de cossos intracel·lulars electrodensos.

Y. Blanco forní Parro de LDChip. Es tracta d’un xip que conté 200 anticossos que reaccionen davant de lisats crus de bacteris i arqueons, així com de proteïnes i pèptids implicats en funcions metabòliques (fixació de nitrogen, fixació de carboni, metabolisme del ferro, oxidació del sofre, metanogènesi, etc.). Així les mostres d’aigua foren processades i analitzades en aquests microarrays.

Les tres llacunes hipersalines de Yungay

D’acord amb les dades de cromatografia de bescavi iònic, de ICP-MS i de XRD les aigües de les tres llacunes estudiades presenten unes característiques físico-químiques que es corresponen a la composició salina i la variabilitat dels sòls que les envolten. És cert, però, que les tres llacunes difereixen en els nivells de calci i de sulfat.

En els sòls d’aquesta zona s’havien reportat un mínim de 16 espècies microbianes endolítiques i hipolítiques. Les llacunes hipersalines resultats de les pluges de juny no mostraven pas aquesta diversitat microbiana. A través de les anàlisis genètiques, Azua-Bustos et al. no han pogut trobar rastre d’espècies arqueanes o eucariòtiques. Les úniques seqüències detectades en les llacunes són bacterianes, i més del 60% d’aquestes seqüències pertanyen a tan sols quatre unitats taxonòmiques operatives: Halomonas, Marinimicrobium, Marinobacter i Acinetobacter. Totes quatre unitats pertanyen a la classe dels gammaproteobacteris, i suposen la pràctica totalitat dels bacteris presents.

La biodiversitat de les llacunes és inferior com més elevada és la salinitat. En aquest sentit, la tolerància a la salinitat de Marinimicrobium i Marinobacter és més elevada que la d’Halomonas i Acinetobacter.

L’observació de les mostres d’aigua de les llacunes amb microscòpia de fluorescència mostrà l’absència d’espècies fotosintètiques (cianobacteris i microalgues). Aquesta absència fou confirmada per la microscòpia de camp brillant, a més de les per les proves genètiques.

Les electrografies de transmissió sobre les mostres d’aigua mostraven la presència de tan sols quatre morfotips diferents. Un d’aquests morfotips és una cèl·lula amb un sol flagel lateral, que es podria correspondre a Halomonas. Un altre és d’una cèl·lula amb un sol flagel polar, que es podria correspondre a Marinimicrobium i a Marinobacter. Un tercer morfotip mostra, a més d’aquest sol flagel polar, dos pols foscos distintius, tal com passa en Marinobacter.

Les electromicrografies de transmissió de mostres de les llacunes indicaven la presència de quatre morfotips: A, B, C i D (A). Entre aquests morfotips trobem cèl·lules amb un sol flagel lateral i d’altres amb un sol flagel polar (B). Les seqüències genètiques fan que Azua-Bustos et al. descriguin l’espècie “Halomonas yungayensis”, de la qual fan l’anàlisi filogenètica (C)

De les mostres d’aigua tan sols aconsegueixen el cultiu de microorganismes quan empren un medi de cultiu “marí”, i això tan sols en mostres de les llacunes gran i mitjana. A partir d’un d’aquests cultius, d’acord amb les dades d’ERIC i de 16S, descriuen una espècie nova, que denominen Halomonas yungayensis. Aquesta espècie, com altres Halomonas, creix en plaques d’agar formant colònies de color blanc-groc, que es tornen un bru lleuger amb el temps.

En la llacuna petita, la més salina, hom detecta la presència per anàlisi genètica de Marinimicrobium i Marinobacter, però no han aconseguit cultivar-les.

Les anàlisis lipídiques de les mostres d’aigua de les llacunes mostren concentracions extremadament baixes. No s’hi detecten ni àcids n-carboxílics insaturats, ni n-alcanols, ni tampoc isoprenoids (pristà, fità, etc.), ni esterols. L’absència de fità ve a confirmar la completa absència d’organismes clorofíl·lics. L’absència d’esterols indica la completa absència de cèl·lules eucariòtiques. És en les llacunes més grans on trobem uns nivells més elevats d’alguns àcids n-carboxílics, com ara el 16-metil-heptadecanoic, que són producte de l’activitat metabòlica de bacteris.

Les quatre unitats taxonòmiques i morfotípiques trobades en les llacunes hipersalines analitzades es corresponen, d’acord amb les dades genètiques, amb espècies que habitaven prèviament els sòls hiperàrids d’aquest indret.

Les dades del LDCChip indiquen que la formació de la llacunes produïa una severa disrupció dels ecosistemes dels sòls preexistents. En efecte, a través del xip hom detecta biomarcadors associats a alfaproteobacteris, betaproteobacteris, gammaproteobacteris, firmicutes, actinobacteris, bacteroidetes, cianobacteris, etc. El xip indica la presència de proteïnes relacionades amb la fixació de nitrogen, de metabolisme de ferro, d’emmagatzematge de carboni i de components d’halovirus. D’alguna manera aquesta detecció immunològica, combinada amb l’absència de senyals detectables per microscòpia o per anàlisi genètica, és indicativa del naufragi patit per aquesta comunitat microbiana, de la qual tan sols haurien sobreviscut quatre grups de gammaproteobacteris. El cas més il·lustratiu potser és el dels cianobacteris (com halotecis o clorococcals), que són presents en el sòl hiperàrid d’Atacama, i que en canvi tan sols es detecten en forma de traça, ja sense integritat ni activitat metabòlica, en les llacunes formades arran de la pluja de juny del 2017.

Xeròfils ofegats

En les zones de Yungay inundades cinc mesos després de la pluja del juny del 2017 havien desaparegut, doncs, entre el 75% i el 87% de les espècies detectades originàriament en els sòls hiperàrids. En la llacuna més petita i més salina, amb una concentració prou elevada de sulfats com per tindre una tonalitat verdosa, únicament hi sobrevivien dues espècies de bacteris.

Segons Azua-Bustos et al. una entrada massiva i sobtada d’aigua en regions que han romàs extremadament àrides durant milions d’anys provoca una disrupció de la majoria de comunitats microbianes. Cal pensar que l’exposició sobtada a grans quantitats d’aigua per espècies adaptades a sobreviure amb molt poca quantitat d’aigua produeix un xoc osmòtic letal. Per corroborar aquesta hipòtesi, caldrà un estudi més perllongat en el temps, a mesura que les llacunes formades vagin recedint. També cadria incloure en l’estudi mostres de sòl més fondes, més enllà dels 15 cm de fondària, per saber si foren afectats per la presència de la llacuna durant un temps més o menys perllongat.

En aquest sentit, doncs, el grup d’Azua-Bustos i Fairén treballa en mostres de la superfície i de la subsuperfície de sòls que han estat bé humitejats o submergits. També fan el seguiment de la diversitat microbiana en les llacunes a mesura que s’evaporen.

Què ens pot ensenyar Yungay sobre Mart?

A més de fer part del Centro de Astrobiología de Madrid, Azua-Bustos és membre de l’Instituto de Ciencias Biomédicas de la Universidad Autónoma de Chile, i Fairén és membre del Department of Astronomy de la Cornell University. Atacama els atreu per la informació que el pugui donar sobre qüestions fonamentals de la biologia i, en particular, sobre la hipotètica biologia marciana.

Yungay es troba en el “nucli d’Atacama”. Aquest nucli no es defineix tant per les dades meteorològiques com per la distribució dels dipòsits de nitrats. Els dipòsits de nitrats de la zona tenen una antiguitat de 13 milions d’anys. El dipòsit de nitrats proper a Yungay fou explotat des de les darreries del segle XIX. Aquests dipòsits són testimonis d’una activitat fluvial pretèrita, que arrossegà nitrats cap al fons de les valls. Segons Azua-Bustos et al. els dipòsits també s’han d’haver alimentat a partir de nitrats atmosfèrics, aportats per inundacions ben espaiades, i acumulats per la pràctica absència de microorganismes denitrificadors.

Dipòsits de nitrats semblants s’han detectats en sediments marcians. Es desconeix, però, si a Mart es desenvolupà un cicle de nitrogen, amb components abiòtics o biòtics. Segons Azua-Bustos et al., els dipòsits de nitrats de Yungay mostren la possibilitat que a Mart es formessin aquests dipòsits a través d’un procés d’extrema eixutesa puntuat amb inundacions extremes que arrosseguessin els nitrats cap a les fondalades, on l’evaporació implacable concentrava els nitrats sense que processos abiòtics o biòtics els consumissin.

El Mart primigeni devia comptar, fa entre 4,5 i 3,5 milers de milions d’anys, amb una hidrosfera superficial activa. Aquesta hidrosfera superficial, després, s’anà dessecant fins arribar a la situació actual hiperàrida del planeta. En la transició l’evaporació secular era contrarestada episòdicament per enormes inundacions, testimoni de les quals són els canals més voluminosos que es coneixen de tot el Sistema Solar. Fins ara, hom veia aquestes inundacions com moments favorables per als hipotètics ecosistemes moribunds de Mart, però Azua-Bustos et al. pensen més aviat que aquestes inundacions tingueren un efecte detrimental sobre una hipotètica microbiota marciana adaptada a la hiperaridesa.

Amb aquest raonament, Azua-Bustos et al. arriben a qüestionar els resultats dels experiments biològics realitzats per les sondes Viking en el 1976. Els experiments de bescanvi de gas i d’alliberament de marcatge començaven a fet incubant mostres de sòl marcià amb diverses solucions aquoses. Aquesta aigua excessiva hauria suposat un estrès osmòtic insuportable per a les hipotètiques cèl·lules marcianes. A més, el caràcter altament oxidant de la regolita marciana, exposada a aquesta aigua, hauria destruït les molècules orgàniques presents, i d’ací l’absència de detecció per part de la Viking.

Aprendre, doncs, de les comunitats microbianes ultraxeròfiles d’Atacama ens pot ajudar per dissenyar experiments més robustos i menys ambigus per a la detecció dels hipotètics microorganismes que podria haver a la superfície o a la subsuperfície del Mart actual.

Lligams:

Unprecedented rains decimate surface microbial communities in the hyperarid core of the Atacama Desert. A. Azua-Bustos, A. G. Fairén, C. González-Silva, C. Ascaso, D. Carrizo, M. Á. Fernández-Martínez, M. Fernández-Sampedro, L. García-Descalzo, M. García-Villadangos, M. P. Martin-Redondo, L. Sánchez-García, J. Wierzchos & V. Parro. Scientific Reports 8: 16706 (2018)

Aquesta entrada ha esta publicada en 3. La Vida. Afegeix a les adreces d'interès l'enllaç permanent.

Deixa un comentari

L'adreça electrònica no es publicarà. Els camps necessaris estan marcats amb *

Aquest lloc utilitza Akismet per reduir el correu brossa. Aprendre com la informació del vostre comentari és processada