La 26a Conferència General de Pesos i Mesures aprova les redefinicions de les unitats bàsiques del Sistema Internacional

Avui la Conferència General de Pesos i Mesures (CGPM) ha aprovat per unanimitat la proposta realitzada pel Comitè Internacional de Pesos i Mesures. Aquestes noves definicions entraran en vigor el 20 de maig del 2019.

Diagrama de relacions entre les unitats base del Sistema Internacional i les constants físiques que les defineixen

Les noves definicions

“El segon, simbolitzat s, és la unitat SI de temps. Es defineix en prendre com a valor numèric fixat de la freqüència de cesi ΔνCs, la freqüència de transició hiperfina de l’estat basal no-pertorbat de l’àtom de cesi-133, el de 9.192.631.770 expressat en la unitat Hz (hertz), que és igual al s-1

Fonamentalment, aquesta definició no ha canviat pas amb aquesta revisió, però formalment ara expressa millor el fet que el segon depèn d’un fenomen natural d’escala atòmica, Δν(133Cs)hfs.

“El metre, simbolitzat m, és la unitat SI de longitud. Es defineix en prendre com a valor numèric fixat de la velocitat de la llum en el buit (constant c) 299.792.458 quan s’expressa en m·s-1, on el segon es defineix en termes de la freqüència de cessi ΔνCs“>/p>

De manera semblant, la revisió tan sols prova de remarcar el fet que el metre depèn de la definició del segon a través de la constant c de la velocitat de la llum en el buit. Aquesta constant c és fonamental en explicar les relacions entre les dimensions espacials i la dimensió temporal.

“El quilogram, simbolitzat kg, és la unitat SI de massa. Es defineix en prendre com a valor numèric fixat de la constant de Planck (constant h) 6.62607015·10-34 quan s’expressa en J·s, que és igual a kg·m2·s-1, on el metre i el segon es defineixen en termes de c i de ΔνCs

Aquesta redefinició evita la situació actual en la qual el quilogram era definit a través del seu prototip internacional. D’altra banda, fa que el valor de la constant de Planck quedi fixat en termes d’unitats de SI. La constant de Planck relaciona l’energia d’un fotó amb la seva freqüència, i d’ací que s’expressi en unitats d’energia/temps. La unitat d’energia J (joule) és una unitat derivada del quilogram, del metre i del segon.

“L’amperi, simbolitzat A, és la unitat SI de corrent elèctric. Es defineix en prendre com a valor numèric fixat de la càrrega elemental (constant e) 1.602176634·10-19 quan s’expressa en C, que és igual a A·s, on el segon es defineix en termes de ΔνCs

Aquesta redefinició evita que l’amperi es defineixi a través d’un sistema experimental de caràcter ideal. Ara fa que la càrrega de l’electró adopti un valor fix en termes d’unitats de SI. Per contra, passen a tindre un valor flotant en aquestes unitats tres altres constants: la permeabilitat del buit, la permitivitat del buit i la impedància d’espai lliure.

“El kelvin, simbolitzat K, és la unitat SI de temperatura termodinàmica. Es defineix en prendre com a valor numèric fixat de la constant de Boltzmann (constant k) 1.380649·10-23 quan s’expressa en J·K-1, que és igual a kg·m2·s-2·K-1, on quilogram, metre i segon es defineixen en termes d’h, c i ΔνCs

Aquesta redefinició evita que el kelvin s’hagi de definir a través del triple punt de l’aigua. La nova definició fa que la constant de Boltzmann tingui un valor fix en termes d’unitats de SI. La constant de Boltzmann vincula l’energia cinètica de les partícules a la temperatura.

“El mol, simbolitzat mol, és la unitat SI de quantitat de substància. Un mol conté exactament 6.02214076·1023 partícules elementals. Aquest nombre és el valor numèric fix de la constant d’Avogadro, NA, quan s’expressa en la unitat mol-1 i és anomenada nombre d’Avogadro”.

Aquesta redefinició evita que el mol es fonamenti en la massa atòmica del carboni-12 expressada en quilograms. Converteix en un valor fix la constant d’Avogadro que vincula nombre de partícules amb quantitat de substància. Per contra passa a adoptar un valor flotant la constant de massa molar.

“La candela, simbolitzada cd és la unitat SI d’intensitat lluminosa en una determinada direcció. Es defineix en prendre com a valor numèric fixat de l’eficàcia lluminosa d’una radiació monocromàtica de freqüència 540·1012 Hz (Kcd) 683 quan s’expressa en la unitat lm·W-1, que és igual a cd·sr·W-1 o a cd·sr·kg-1·m-2·s3, on quilogram, mentre i segon es defineixen en termes d’h, c i ΔνCs

Aquesta definició no fa més que remarcar la dependència de la candela respecte del quilogram, del metre i del segon, a través de la relació entre la freqüència electromagnètica i la intensitat lluminosa.

Video de la sessió

Publicat dins de 6. La Civilització | Envia un comentari

Una super-Terra freda al voltant de l’estel de Barnard: GJ699 b

En el 1963, Peter van de Kamp va presentar les dades d’un estudi astromètric de l’estel de Barnard amb les quals hipotetitzava la presència al voltant d’aquest estel d’un o més planetes d’una massa joviana. En el 1973 aquesta proposta era descartada amb mesures més precises de George Gatewood i Heinrich Eichhorn. Haurien de passar dues dècades més per a la detecció contrastada d’exoplanetes en altres estels. Des de llavors, hom ha anat investigant l’estel de Barnard a la recerca de planetes. Demà a la revista Nature apareixerà un article d’un equip internacional d’astrònoms on presenten dades d’una “super-Terra freda” orbitant l’estel de Barnard en la “línia de neu”. El primer autor de l’article és Ignasi Ribas, de l’Institut de Ciències de l’Espai de Bellaterra, i el darrer és Guillem Anglada-Escudé.

Un estel emblemàtic

L’Estel de Barnard té una magnitud aparent de +12,497. És lògic, doncs, que no fos catalogat dins de la constel·lació de Serpentari fins l’adveniment de l’era astrofotogràfica, el 1888. De totes maneres rebé aquest nom propi arran dels estudis d’E. E. Barnard sobre moviment propi dels estels (Barnard, 1916). Amb un moviment propi de 10,3 arcsegons en el component tangencial, l’anomenat Estel de Barnard superava i supera tots els registres en aquest sentit. Aquest moviment propi s’explica perquè és un estel relativament proper al nostre Sistema Solar, a una distància de 1,8 parsecs. Es tracta d’un estel solitari, i en aquest sentit és l’estel solitari més proper al Sol (ja que Alfa Centauri és un sistema estel·lar triple). L’Estel de Barnard és un dels nans vermells més intensament estudiats. També és un dels nans vermells menys actius magnèticament.

El fort moviment propi i la poca activitat magnètica el van fer interessant, ja en els anys 1930, en la investigació exoplanetològica. Des de llavors hom ha explorat sense èxit la presència de planetes al voltant d’aquest estel amb mesures de la velocitat radial, l’astrometria i fins i tot amb astrofotografies.

Ribas et al. han combinat nombroses mesures d’alta precisió de velocitat radial fetes durant els darrers 20 anys, amb les quals han identificat la presència d’un senyal periòdic de 233 dies. Ho atribueixen a un planeta, atribució que reforcen amb dades fotomètriques i espectroscòpiques. Aquest planeta hauria d’ésser una super-Terra, amb una massa, com a mínim, 3,2 vegades superior a la del nostre planeta. El seu període orbital de 233 dies el situa en l’anomenada “línia de neu” de l’Estel de Barnard. Calculen que la separació angular màxima que ofereix aquesta òrbita seria de 0,22 arcsegons, de manera que podria ser accessible a la detecció telescòpica directa o a l’observació astromètrica amb futurs telescopis orbitals. De moment, però, les dades que tenim són de velocitat radial, fotometria i espectroscopia.

La detecció de GJ699b

El punt de partida de Ribas et al. fou l’anàlisi de les velocitats radials obtingudes de l’Estel de Barnard fins el 2015. En aquests arxius era possible observar, com a mínim, un senyal amb un període de 230 dies. Es tractava, però, d’un senyal de baixa amplitud, que requeria observacions precises. Així doncs, Ribas et al. iniciaren una campanya intensiva de monitorització de l’estel amb l’espectròmetre CARMENES: cada nit del 2016 i 2017 que fou possible s’obtingueren mesures precises de velocitat radial. Paral·lelament, es feien observacions amb els instruments ESO/HARPS i HARPS-N.

La combinació de les dades d’arxiu i les de nova adquisició abastà un total de 771 nits, en les quals la precisió de velocitat radial era de 0,9-1,8 m·s-1. Aquestes 771 nits es distribuïen en un període de 20 anys, procedents de set instal·lacions diferents. Amb aquesta combinació de dades el període de 233 dies assolia una significativa estatística alta, amb una probabilitat de falsa alarma de 10-15.

En la velocitat radial d’un estel no actuen únicament planetes orbitants, sinó també factors intrínsecs al propi estel. Les dades fotomètriques indiquen que l’Estel de Barnard té un període de rotació de 130 dies (mentre que les dades espectroscòpiques valoren en 148,6 dies). Ribas et al. analitzen dades fotomètriques i espectroscòpiques (fluxos cromosfèrics de Hα i Ca II H&K) per estudiar els períodes corresponents d’activitat estel·lar. Les sèries fotomètriques indiquen un senyal periòdic de 144 dies, les sèries de Hα un de 133 dies, i els índexs cromosfèrics de Ca II un de 143. Ribas et al. atribueixen aquests períodes a una rotació estel·lar de 140 dies. Es tracta d’un període prou separat com per no confondre’s amb el període de 230 dies.

Que el període de 233 dies sigui de natura planetària seria refermat pel fet que, acumulant observacions, es guanya monotònicament en significància estatística. Això és més propi d’una òrbita kepleriana que no pas d’una activitat estel·lar que tindria un caràcter més aleatori.

Una super-Terra freda

Ribas et al. estimen que el responsable del període de 233 dies en la velocitat radial de l’Estel de Barnard seria un planeta amb una massa 3,2 vegades superior a la de la Terra. Aquest planeta seguira una òrbita de baixa excentricitat, amb una distància mitjana de l’estel de 0,4 unitats astronòmiques.

Les dades de Ribas et al. són també prou precises com per refermar la idea que l’Estel de Barnard no tindria cap planeta d’una massa similar o superior a la de la Terra en òrbites inferiors. Això explicaria la manca de deteccions en prospeccions anteriors.

La confirmació del planeta per una detecció astromètrica semblaria a l’abast per missions com Gaia o HST, que tenen una capacitat de resolució de 0,03 miliarcsegons. Segons quina sigui la inclinació del pla orbital de GJ669b aquesta resolució seria suficient com per detectar i estudiar el planeta de manera directa

Publicat dins de 1. L'Univers | Envia un comentari

L’impacte de les pluges sobre la microbiota de la zona hiperàrida del Desert d’Atacama

Ecologia microbiana: El Desert d’Atacama és l’indret més àrid de la terra. Per minses que puguin semblar en termes absoluts, els episodis de pluja registrats en els darrers tres anys a la zona central d’Atacama no tenen precedents. Com a resultat d’aquestes pluges s’han formats llacs hipersalins que, en alguns casos, han perdurat durant mesos. Aquest ambient inusitat impulsà el grup de recerca d’Armando Javier Azúa Bustos i de Alberto G. Fairén, del Centro de Astrobiología del CSIC-INTA, de Madrid, a fer-hi un seguiment de les comunitats microbianes, com si es tractés d’un model de Mart a la Terra. En un article a Scientific Reports ofereixen una anàlisi sistemàtica de l’evolució de les llacunes formades especialment enfocat a les comunitats microbianes locals. Cal recordar que algunes d’aquestes zones haurien estat completament àrides en els darrers milions d’anys. L’entrada sobtada i massiva d’aigua, segons mostren Azua-Bustos et al. perjudicà la majoria d’espècies microbianes que viuen en la superfície del sòl. Es tracta de microorganismes xeròfils, adaptats a sobreviure amb quantitats molt magres d’aigua, i que pogueren resistir el xoc osmòtic provocat per la pluja. Així doncs, en aquestes llacunes hipersalines tan sols un nombre reduït de bacteris hi són metabòlicament actius. Azua-Bustos et al. descriuen entre aquests bacteris, una espècie prèviament desconeguda, Halomonas yungayensis. És interessant, doncs, constatar que la pluja sobtada i voluminosa té un efecte depressor en la diversitat de les comunitats microbianes de sòls de regions hiperàrides. Azua-Bustos et al. utilitzen aquest estudi per reflexionar sobre les condicions de Mart, “un planeta hiperàrid que experimentà inundacions catastròfiques en temps antics“.

El 7 de juny del 2017 va ploure a la zona de Yungay. Azua-Bustos et al. visitaren el 8 de juliol del 2017 (A). L’11 de novembre del 2017 hi feren una altra visita als llacs grans (B), mitjà (C) i petit (D)

Yungay, Atacama

Aquesta recerca fou concebuda per Azua-Bustos i per Fairén, que foren els qui dirigiren l’estudi i redactaren l’article. Cal recordar que Azua-Bustos també és membre del Instituto de Ciencias Biomédicas de la Facultad de Ciencias de la Salud de la Universidad Autónoma de Chile. L’estudi in situ i la recollida de mostres la va fer Carlos González-Silva, de la Facultad de Ciencias de la Universidad de Tarapacá, de Arica. La preparació de mostres i l’obtenció de electromicrografies de transmissió anaren a càrrec de Jacek Wierzchos i Carmen Ascaso, del Museo Nacional de Ciencias Naturales de Madrid. El cultiu de les mostres i l’aïllament de microorganismes els feren Azua-Bustos i Laura García Descalzo, que també és membre del Departamento de Planetología y Habitabilidad del Centro de Astrobiología. Azua-Bustos realitzà el genotipat d’elements repetitius ERIC1, l’amplificació del gen del ARNr 16S, i l’anàlisi filogenètica. Les anàlisis de de seqüenciació les realitzà Miguel Ángel Fernández Martínez, el Departamento de Evolución Molecular del Centro de Astrobiología. L’extracció de lípids, fraccionament i anàlisi per cromatografia de gasos i espectrometria de masses la feren Daniel Carrizo i Laura Sánchez García, del Departamento de Evolución Molecular. També del mateix Departament és Miriam García Villadangos, que realitzà l’anàlisi de cromatografia iònica. María Paz Martín Redondo, del Departamento de Planetología y Habitabilidad, realitzà l’espectrometria de masses de plasma acoblat inductivament. Víctor Parro, del Departamento de Evolución Molecular, féu el serotipat per microarray. Mª Teresa Fernández Sampedro, del Departamento de Planetología y Habitabilidad, realitzà l’anàlisi de difracció de raigs X.

Aquesta recerca es va fer en el marc del projecte “icyMARS”, finançant pel Consell Europeu de Recerca. Fairén i Pardo també reben finançament del Ministeri d’Educació d’Espanya i del programa FEDER pel seu projecte de detecció de biomolècules en l’exploració planetària. També tenen paraules d’agraïment per a Virginia Souza-Egipsy en la interpretació de les electrografies.

El Desert d’Atacama, en el nord de Xile, situat entre la Serralada dels Andes a l’est, i la Serralada Litoral a l’oest, ocupa uns 105.000 km2. En la zona central trobem un clima hiperàrid, que ha suportat condicions d’aridesa durant els darrers 150 milions d’anys, i condicions d’hiperaridesa durant els darrers 15 milions. En aquesta zona la precipitació anual mitjana es troba per sota dels 4 mm/m2. No és estrany que hom hagi proposat la regió de Yungay, dins d’aquesta zona hiperàrida, com un bon model per als estudis de Mart.

L’eixutesa extrema, l’elevat contingut salí del sòl (particularment enriquit en nitrats, sulfats i perclorats) i l’extremada pobresa en matèria orgànica fan de la regió de Yungay un indret força inhòspit. Tanmateix, és un indret amb vida microbiana. Bacteris, arqueons i eucarionts de Yungay comparteixen una elevada tolerància a la sequedat, a l’elevada salinitat i a la radiació ultraviolada.

Imatges del Desert d’Atacama durant el primer terç del mes de juny del 2017. L’aridesa de la regió s’explica pel fet que la Serralada Litoral constitueix una barrera per als núvols que arriben del Pacífic: no debades, el vessant marítim de la Serralada Litoral és un dels indrets amb més precipitacions anuals del món. Entre el 5 i el 7 de juny del 2017, núvols de pluja creuaren no obstant la serra i precipitaren a Atacama, bé en forma de pluja, en les zones baixes, o de neu

Si bé en la perifèria del Desert d’Atacama no són del tot infreqüents les precipitacions de pluja o de neu durant “l’hivern altiplànic”, entre el desembre i el març, degut a corrents d’aire humit de llevant que creuen els Andes, la zona central d’Atacama no és exposada a aquestes situacions. En els darrers quatre anys, no obstant s’han registrat tres pluges remarcables per l’entrada de vents de ponents:
– la del 25 de març del 2015.
– la del 9 d’agost del 2015.
– la del 7 de juny del 2017.

Aquests tres episodis de pluges, juntament amb altres de menor quantia, han fet que la precipitació anual per al període 2015-2017 hagi estat de fins a 40 mm/m2, és a dir deu vegades superior de la mitjana climàtica. D’acord amb els registres paleometeorològics, aquesta situació no té precedents en els darrers 500 anys.

Com a resultat d’aquests episodis de pluja es formaren llacunes a la regió de Yungay per primera vegada en la història documentada. El novembre del 2017 encara sobrevivien tres llacunes a la regió de Yungay cinc mesos després de la pluja del 7 de juny. Aquestes tres llacunes foren l’objecte de l’estudi d’Azua-Bustos et al.

El mostreig de tres llacunes hipersalines

L’11 de novembre del 2017 es procedí una presa de mostres en tres llacunes de la regió hiperàrida de Yungay. Les mostres les prengué González-Silva amb guants estèrils, abocant-les a tubs falcon de 50 ml.

La cromatografia iònica permeté la quantificació d’anions d’aquestes mostres. Per espectrometria de masses ICP-MS es feren determinacions d’elements (Mn, Cu, Co, Cd, Ba, Na, Mg, K, Ca, Fe, Ni, Zn, As).

La composició mineralògica de les aigües fou estudiada per difracció de raigs X (XRD).

El contingut lipídic de les mostres fou analitzat per cromatografia gasos acoblada a espectrometria de masses (GC-MS), diferenciant entre les fraccions apolar, acídica i polar.

Per a l’extracció d’ADN, les mostres eren centrifugades i als pellets resultants se’ls aplicava el DNeasy PowerSoil Kit.

Dels extractes d’ADN es feien amplificacions de la regió V3-V4 del gen rDNA 16S amb els encebadors 5′-ACACTGACGACATGGTTCTACACCTACGGGNGGCWGCAG-3′ i 5′-TACGGTAGCAGAGACTTGGTCTGACTACHVGGGTATCTAATCC-3′ en els primers cicles. Els amplicons obtinguts eren validats i quantificats, i seguidament seqüenciats.

Alíquotes d’1 mL de les mostres foren incubades aeròbicament a 25°C en agar amb diferents medis, i se’n seguí el creixement durant 2 setmanes. De les colònies obtingudes es féu una extracció d’ADN i una seqüenciació del gen rDNA 16S.

Extractes d’ADN de les colònies obtingudes també foren analitzats amb encebadors ERIC (5′AAGTAAGTGACTGGGGTGAGCG3′ i 5′-ATGTAAGCTCCTGGGGATTCAC-3′), que amplifiquen seqüències repetitives intergèniques de consens entre enterobacteris. Si el gen rDNA 16S permet una classificació taxonòmica a l’engròs, la tècnica de PCR-ERIC, sense necessitat de seqüenciació, ajuda a afinar a nivell d’espècie.

Mostres dels cultius obtinguts de la llacuna gran i de la petita foren destinades a la microscòpia electrònica de transmissió. Com a tècnica de tinció s’utilitzà la negativa de fosfotungstat de sodi. Les electrografies permetien caracteritzar els diferents morfotips de cada cultiu bacterià: mida, forma, presència o absència de flagels i la seu nombre i inserció, presència o absència de cossos intracel·lulars electrodensos.

Y. Blanco forní Parro de LDChip. Es tracta d’un xip que conté 200 anticossos que reaccionen davant de lisats crus de bacteris i arqueons, així com de proteïnes i pèptids implicats en funcions metabòliques (fixació de nitrogen, fixació de carboni, metabolisme del ferro, oxidació del sofre, metanogènesi, etc.). Així les mostres d’aigua foren processades i analitzades en aquests microarrays.

Les tres llacunes hipersalines de Yungay

D’acord amb les dades de cromatografia de bescavi iònic, de ICP-MS i de XRD les aigües de les tres llacunes estudiades presenten unes característiques físico-químiques que es corresponen a la composició salina i la variabilitat dels sòls que les envolten. És cert, però, que les tres llacunes difereixen en els nivells de calci i de sulfat.

En els sòls d’aquesta zona s’havien reportat un mínim de 16 espècies microbianes endolítiques i hipolítiques. Les llacunes hipersalines resultats de les pluges de juny no mostraven pas aquesta diversitat microbiana. A través de les anàlisis genètiques, Azua-Bustos et al. no han pogut trobar rastre d’espècies arqueanes o eucariòtiques. Les úniques seqüències detectades en les llacunes són bacterianes, i més del 60% d’aquestes seqüències pertanyen a tan sols quatre unitats taxonòmiques operatives: Halomonas, Marinimicrobium, Marinobacter i Acinetobacter. Totes quatre unitats pertanyen a la classe dels gammaproteobacteris, i suposen la pràctica totalitat dels bacteris presents.

La biodiversitat de les llacunes és inferior com més elevada és la salinitat. En aquest sentit, la tolerància a la salinitat de Marinimicrobium i Marinobacter és més elevada que la d’Halomonas i Acinetobacter.

L’observació de les mostres d’aigua de les llacunes amb microscòpia de fluorescència mostrà l’absència d’espècies fotosintètiques (cianobacteris i microalgues). Aquesta absència fou confirmada per la microscòpia de camp brillant, a més de les per les proves genètiques.

Les electrografies de transmissió sobre les mostres d’aigua mostraven la presència de tan sols quatre morfotips diferents. Un d’aquests morfotips és una cèl·lula amb un sol flagel lateral, que es podria correspondre a Halomonas. Un altre és d’una cèl·lula amb un sol flagel polar, que es podria correspondre a Marinimicrobium i a Marinobacter. Un tercer morfotip mostra, a més d’aquest sol flagel polar, dos pols foscos distintius, tal com passa en Marinobacter.

Les electromicrografies de transmissió de mostres de les llacunes indicaven la presència de quatre morfotips: A, B, C i D (A). Entre aquests morfotips trobem cèl·lules amb un sol flagel lateral i d’altres amb un sol flagel polar (B). Les seqüències genètiques fan que Azua-Bustos et al. descriguin l’espècie “Halomonas yungayensis”, de la qual fan l’anàlisi filogenètica (C)

De les mostres d’aigua tan sols aconsegueixen el cultiu de microorganismes quan empren un medi de cultiu “marí”, i això tan sols en mostres de les llacunes gran i mitjana. A partir d’un d’aquests cultius, d’acord amb les dades d’ERIC i de 16S, descriuen una espècie nova, que denominen Halomonas yungayensis. Aquesta espècie, com altres Halomonas, creix en plaques d’agar formant colònies de color blanc-groc, que es tornen un bru lleuger amb el temps.

En la llacuna petita, la més salina, hom detecta la presència per anàlisi genètica de Marinimicrobium i Marinobacter, però no han aconseguit cultivar-les.

Les anàlisis lipídiques de les mostres d’aigua de les llacunes mostren concentracions extremadament baixes. No s’hi detecten ni àcids n-carboxílics insaturats, ni n-alcanols, ni tampoc isoprenoids (pristà, fità, etc.), ni esterols. L’absència de fità ve a confirmar la completa absència d’organismes clorofíl·lics. L’absència d’esterols indica la completa absència de cèl·lules eucariòtiques. És en les llacunes més grans on trobem uns nivells més elevats d’alguns àcids n-carboxílics, com ara el 16-metil-heptadecanoic, que són producte de l’activitat metabòlica de bacteris.

Les quatre unitats taxonòmiques i morfotípiques trobades en les llacunes hipersalines analitzades es corresponen, d’acord amb les dades genètiques, amb espècies que habitaven prèviament els sòls hiperàrids d’aquest indret.

Les dades del LDCChip indiquen que la formació de la llacunes produïa una severa disrupció dels ecosistemes dels sòls preexistents. En efecte, a través del xip hom detecta biomarcadors associats a alfaproteobacteris, betaproteobacteris, gammaproteobacteris, firmicutes, actinobacteris, bacteroidetes, cianobacteris, etc. El xip indica la presència de proteïnes relacionades amb la fixació de nitrogen, de metabolisme de ferro, d’emmagatzematge de carboni i de components d’halovirus. D’alguna manera aquesta detecció immunològica, combinada amb l’absència de senyals detectables per microscòpia o per anàlisi genètica, és indicativa del naufragi patit per aquesta comunitat microbiana, de la qual tan sols haurien sobreviscut quatre grups de gammaproteobacteris. El cas més il·lustratiu potser és el dels cianobacteris (com halotecis o clorococcals), que són presents en el sòl hiperàrid d’Atacama, i que en canvi tan sols es detecten en forma de traça, ja sense integritat ni activitat metabòlica, en les llacunes formades arran de la pluja de juny del 2017.

Xeròfils ofegats

En les zones de Yungay inundades cinc mesos després de la pluja del juny del 2017 havien desaparegut, doncs, entre el 75% i el 87% de les espècies detectades originàriament en els sòls hiperàrids. En la llacuna més petita i més salina, amb una concentració prou elevada de sulfats com per tindre una tonalitat verdosa, únicament hi sobrevivien dues espècies de bacteris.

Segons Azua-Bustos et al. una entrada massiva i sobtada d’aigua en regions que han romàs extremadament àrides durant milions d’anys provoca una disrupció de la majoria de comunitats microbianes. Cal pensar que l’exposició sobtada a grans quantitats d’aigua per espècies adaptades a sobreviure amb molt poca quantitat d’aigua produeix un xoc osmòtic letal. Per corroborar aquesta hipòtesi, caldrà un estudi més perllongat en el temps, a mesura que les llacunes formades vagin recedint. També cadria incloure en l’estudi mostres de sòl més fondes, més enllà dels 15 cm de fondària, per saber si foren afectats per la presència de la llacuna durant un temps més o menys perllongat.

En aquest sentit, doncs, el grup d’Azua-Bustos i Fairén treballa en mostres de la superfície i de la subsuperfície de sòls que han estat bé humitejats o submergits. També fan el seguiment de la diversitat microbiana en les llacunes a mesura que s’evaporen.

Què ens pot ensenyar Yungay sobre Mart?

A més de fer part del Centro de Astrobiología de Madrid, Azua-Bustos és membre de l’Instituto de Ciencias Biomédicas de la Universidad Autónoma de Chile, i Fairén és membre del Department of Astronomy de la Cornell University. Atacama els atreu per la informació que el pugui donar sobre qüestions fonamentals de la biologia i, en particular, sobre la hipotètica biologia marciana.

Yungay es troba en el “nucli d’Atacama”. Aquest nucli no es defineix tant per les dades meteorològiques com per la distribució dels dipòsits de nitrats. Els dipòsits de nitrats de la zona tenen una antiguitat de 13 milions d’anys. El dipòsit de nitrats proper a Yungay fou explotat des de les darreries del segle XIX. Aquests dipòsits són testimonis d’una activitat fluvial pretèrita, que arrossegà nitrats cap al fons de les valls. Segons Azua-Bustos et al. els dipòsits també s’han d’haver alimentat a partir de nitrats atmosfèrics, aportats per inundacions ben espaiades, i acumulats per la pràctica absència de microorganismes denitrificadors.

Dipòsits de nitrats semblants s’han detectats en sediments marcians. Es desconeix, però, si a Mart es desenvolupà un cicle de nitrogen, amb components abiòtics o biòtics. Segons Azua-Bustos et al., els dipòsits de nitrats de Yungay mostren la possibilitat que a Mart es formessin aquests dipòsits a través d’un procés d’extrema eixutesa puntuat amb inundacions extremes que arrosseguessin els nitrats cap a les fondalades, on l’evaporació implacable concentrava els nitrats sense que processos abiòtics o biòtics els consumissin.

El Mart primigeni devia comptar, fa entre 4,5 i 3,5 milers de milions d’anys, amb una hidrosfera superficial activa. Aquesta hidrosfera superficial, després, s’anà dessecant fins arribar a la situació actual hiperàrida del planeta. En la transició l’evaporació secular era contrarestada episòdicament per enormes inundacions, testimoni de les quals són els canals més voluminosos que es coneixen de tot el Sistema Solar. Fins ara, hom veia aquestes inundacions com moments favorables per als hipotètics ecosistemes moribunds de Mart, però Azua-Bustos et al. pensen més aviat que aquestes inundacions tingueren un efecte detrimental sobre una hipotètica microbiota marciana adaptada a la hiperaridesa.

Amb aquest raonament, Azua-Bustos et al. arriben a qüestionar els resultats dels experiments biològics realitzats per les sondes Viking en el 1976. Els experiments de bescanvi de gas i d’alliberament de marcatge començaven a fet incubant mostres de sòl marcià amb diverses solucions aquoses. Aquesta aigua excessiva hauria suposat un estrès osmòtic insuportable per a les hipotètiques cèl·lules marcianes. A més, el caràcter altament oxidant de la regolita marciana, exposada a aquesta aigua, hauria destruït les molècules orgàniques presents, i d’ací l’absència de detecció per part de la Viking.

Aprendre, doncs, de les comunitats microbianes ultraxeròfiles d’Atacama ens pot ajudar per dissenyar experiments més robustos i menys ambigus per a la detecció dels hipotètics microorganismes que podria haver a la superfície o a la subsuperfície del Mart actual.

Lligams:

Unprecedented rains decimate surface microbial communities in the hyperarid core of the Atacama Desert. A. Azua-Bustos, A. G. Fairén, C. González-Silva, C. Ascaso, D. Carrizo, M. Á. Fernández-Martínez, M. Fernández-Sampedro, L. García-Descalzo, M. García-Villadangos, M. P. Martin-Redondo, L. Sánchez-García, J. Wierzchos & V. Parro. Scientific Reports 8: 16706 (2018)

Publicat dins de 3. La Vida | Envia un comentari

Una anàlisi sistemàtica del GBDS-2017 sobre l’evolució de la fertilitat des del 1950

Lancet publicava ahir un article del grup de col·laboradors en població i fertilitat de l’Estudi sobre la Càrrega Global de Malalties del 2017 (GBDStudy2017). Aquest estudi ens presenta estimacions de fertilitat i de població per cada sexe amb mètodes estandarditzats i replicables per a 195 nacions i territoris i per cada any entre el 1950 i el 2017. Les estimacions combinen dades de fertilitat, mortalitat, població i migració. D’això en deriven taxes de fertilitat específiques d’edat, i a partir d’elles les taxes de fertilitat total. Globalment, la taxa de fertilitat total disminuí entre el 1950 i el 2017 en un 49%, passant de 4,7 parts de nadons vius a 2,4. La taxa de fertilitat específica de les dones més joves (10-19 anys) es reduí del 3,7% al 2,2%. Aquesta reducció de la fertilitat no ha anat acompanyada d’una reducció de la població global que, des del 1985, creix a un ritme anual de 83,8 milions de persones. Així doncs, la població global ha passat del 2.600 milions del 1950 a 7.600 milions en el 2017 (un augment de gairebé el 200%). Aquest augment demogràfic s’ha concentrat al Sud d’Àsia i a l’Àfrica Sud-Sahariana. La taxa de creixement anual assolí un pic del 2,0% entre el 1950 i el 1964, per romandre estable fins el 1970, quan començà a decrèixer fins al nivell actual de l’1,1%. Aquest decreixement no és uniforme, i de fet encara no ha començat a l’Àfrica Sud-Sahariana (taxa de creixement del 2,7%). L’edat mitjana global, que era de 26,6 anys en el 1950, és ara de 32,1 anys, de manera que la població en edat de treballar (15-64 anys) ha pujat del 59,9% del 1950 al 65,3% actual. Si ho mirem per països la taxa de fertilitat total més baixa es troba a Xipre (1,0) i la més alta a Níger (7,1). Entre el 2010 i el 2017, 33 països han experimentat una davallada de la població, sobretot a Europa.

Un estudi finançat per la Bill & Melinda Gates Foundation

La finalitat d’aquest estudi és oferir dades demogràfiques el més acurades possibles. En les piràmides d’edat, les variables demogràfiques són estructurades en grups d’edat i en els dos sexes. Ofereixen globalment una estimació de la mida de la població, de l’edat i de la composició. Des del 1951, la Divisió de Població del Departament d’Afers Econòmics i Socials de Nacions Unides (UNPOP) ofereixen estimacions descentralitzades sobre fertilitat, mortalitat, migració i població. Altres organitzacions que forneixen dades globals o regionals són la Divisió Internacional de l’Oficina del Cens dels Estats Units, l’Oficina de Referència de Població, el Banc Mundial, el Centre Wittgenstein o la Fundació Gapminder. Existeixen discrepàncies entre les estimacions d’algunes d’aquestes organitzacions i d’agències nacionals.

L’equació d’equilibri demogràfic

En l’equació:
N(T) = N(0) + B(0,T) – D(0,T) + G(0,T)
N(T) és la població en el temps T, i N(0) és la població en el moment inicial. B(0,T) són els naixements escaiguts en període, D(0,T) les morts que s’hi han produït i G(0,T) és el saldo migratori.

Aquestes dades bàsiques han d’ésser complementades amb informació sobre l’estructura demogràfica: sex ratio, dades específiques d’edat, etc.

Unitats geogràfiques i cronològiques

El GBDStudy contempla 195 països i territoris, agrupats en 21 regions i 7 super-regions. La unitat cronològica és l’any natural.

Les dades de fertilitat

La base d’aquestes dades són els sistemes de registre vital, que inclouen dades de cada dona quant als fills que han tingut i a quina edat els ha tingut.

Les dades de població

En les dades de població s’han inclòs 1233 censos i 26 registres de població. Els censos en general ofereixen subestimacions de la població real.

Lligams:

Population and fertility by age and sex for 195 countries and territories, 1950-2017: a systematic analysis for the Global Burden of Disease Study 2017. GBD 2017 Population and Fertility Collaborators. Lancet 392: 1995-2051 (2018).

Publicat dins de 6. La Civilització | Envia un comentari

Shmuel Bialy i Abraham Loeb sobre ‘Oumuamua (1I/2017 U1): la hipòtesi d’un veler interestel·lar

Astronomia: Ara fa un any, en aquestes planes, comentàvem la descripció de 1I/’Oumuamua, asteroide de trajectòria hiperbòlica pel qual es creà la categoria astronòmicament novedosa d’asteroide interestel·lar (d’ací la designació de 1I). A la designació provisional de 2017 U1 (PANSTARRS) s’afegeix la denominació de ‘Oumuamua, nom del missatger del passat de la mitologia hawaiana. Però si ara 1I/’Oumuamua torna a les planes de notícies és pel ressò que ha tingut un article difós per Shmuel Bialy i Abraham Loeb el 26 d’octubre, amb versió revisada del dia 30 en el que s’arriba a explorar la possibilitat que es tracti un veler artificial interestel·lar, és a dir d’un artefacte d’un altre civilització. Quan hi ha afirmacions d’aquest calibre hi ha un gran interès, com el que despertar, en el moment (1967) de la descoberta dels pulsars la suggerència que podien ésser autèntics fars còsmics artificials, o des de l’any passat tot l’interès que hi ha al voltant de l’estel KIC 8462852. El punt de partida sobre aquestes suggerents afirmacions sobre ‘Oumuamua és l’article de Micheli et al., publicat a Nature el passat de 27 de juny en el que es descriuen les discrepàncies de la trajectòria d’aquest petit planeta respecte d’una trajectòria kepleriana purament gravitacional. Concretament, Micheli et al. presentaven indicis d’una acceleració no-gravitacional (amb un nivell de significació de 30 sigmes). Micheli et al. descartaven que aquesta desviació respongués a la pressió de la radiació solar, a forces d’arrossegament o de fricció o interaccions magnètiques amb el vent solar. Més aviat, Micheli et al. pensaven que es tractava de l’efecte d’un comportament cometari, és a dir del despreniment de partícules volàtils. Bialy & Loeb discrepen de Micheli et al. en aquesta explicació i assumeixen el criteri que ‘Oumuamua no és de cap manera un cometa actiu. Així doncs, calculen si l’excés d’acceleració radial heliocèntrica no seria deguda a la pressió de la radiació solar. És sabut que 1I/’Oumuamua té una forma altament irregular, i Bialy & Loeb calculen què passaria si es tractés d’una “vela llumínica” de centenars de metres de diàmetre, però d’un gruix de 0,3-0,9 mm. Diuen que un objecte d’aquestes característiques podria resistir les condicions d’un viatge interestel·lar de vora 5 kiloparsecs de distància (15 anys-llum). Si realment l’excés d’acceleració radial es deu al vent solar, Bialy & Loeb conclouen ‘Oumuamua que es tractaria d’una sonda lleugera interestel·lar. En aquest cas, sí seria un missatger del passat d’una civilització extrasolar.

Trajectòria de 1I/’Oumuamua. En l’actualitat aquest objecte es trobaria ja entre les òrbites de Júpiter i Saturn

Shmuel Bialy i Abraham Loeb

Shmuel Bialy i Abraham Loeb treballen al Harvard Smithsonian Center for Astrophysics. Ja el desembre del 2017, Loeb havia proposat al Green Bank Telescope, de West Virginia, que explorés la banda de ràdio d’aquest objecte. Val a dir que els registres realitzats pel Green Bank Telescope el dia 13 de desembre, i els que havia fet dies abans l’Allen Telescope Array no havien detectat cap emissió d’origen artificial.

D’acord amb dades de Bailer-Jones et al. 1I/’Oumuamua podria tindre el seu origen, de fa un milió d’anys, a l’estel nan vermell HIP 3757 (que actualment és a uns 80 anys-llum del nostre Sistema Solar) o, alternativament, amb una antiguitat de 3,8 milions d’anys de HD 292249, un estel de dimensions més comparables al del nostre Sol. Existeixen, no obstant, altres candidats.

1I/’Oumuamua: característiques general

La descoberta d’aquest objecte es produí el 19 d’octubre del 2017. El seguiment permeté calcular-ne una trajectòria altament hiperbòlica, amb una excentricitat de 1,1956. S’estimà la velocitat d’entrada al Sistema Solar de 26 km/s. Com que aquesta és la velocitat relativa del Sistema Solar respecte del medi interestel·lar, això i la trajectòria hiperbòlica feren pensar gairebé d’immediat en un origen extrasolar. Hom creà, doncs, per aquest objecte la categoria I, per a asteroides interestel·lars, del qual aquest objecte n’era el primer (“1I”).

La descoberta d’aquest asteroide interestel·lar dugué a una reavaluació de l’estimació de la densitat d’objectes d’aquesta mida (100 m de diàmetre de mitjà) en l’espai interestel·lar, que ara es calcula en 2·1015 pc-3.

Però no només la trajectòria cridà l’atenció als observadors. També ho feren les variacions en la magnitud aparent i una certa complexitat en el període d’aquestes variacions. L’objecte té un elevat i accidental període de rotació. També ha d’ésser molt elongat, si més no amb un ratio 5:1, potser superior. De fet, no es coneix cap asteroide o cometa tan elongat en el nostre Sistema Solar.

Les dades de Micheli et al. (2018) indiquen que a la trajectòria gravitaròria hiperbòlica s’hi suma un excés d’acceleració que seria inversament proporcional al quadrat de la distància respecte del Sol. Micheli et al. pensen que això s’explicaria per l’emissió cometària de volàtils. Ara bé, 1I/’Oumuamua, va arribar a situar-se a 0,25 unitats astronòmiques del Sol en el seu periheli, i hom no trobà mai rastre, ja no d’una cua cometària sinó de línies espectrals d’emissió o absorció de gasos.

Micheli et al. també havien considerat, per descartar-la, una acceleració induïda per la pressió de la radiació solar. Ara Bialy & Loeb la reprenen. La pressió radiant produiria un excés d’acceleració inversament proporcional al quadrat de la distància del Sol respecte de la trajectòria purament gravitatòria. Ara bé, perquè aquest excés expliqués tota la desviació de 1I/’Oumuamua seria necessari que aquest objecte tingués una ratio massa:àrea molt petita. O, dit d’una altra manera, una àrea molt elevada respecte de la massa. De fet, Bialy & Loeb calcular que la m/A hauria d’ésser de 0,1 g·cm-2. Això és el mateix que suposar que l’objecte hauria d’ésser molt prim, amb un gruix de 0,3 a 0,9 mm. Una fulla tan prima d’amplada i llargada de centenars de metres no sembla un objecte gaire estable, tant per la tensió exercida per les forces rotacionals i mareals com per possibles impactes amb la pols i el gas interestel·lars.

Una acceleració per la radiació solar

Respecte d’una trajectòria kepleriana, Micheli et al. estimen que hi ha un excés d’acceleració (∆a):

∆a = 4,92·10-6 m·s-2 · (distància al Sol/unitats astronòmiques)-2.

Si això es degués a la pressió per radiació (P) aquesta seguiria:

P = (CR · Lluminositat solar) / 4·Pi·radi2·c

On CR és un coeficient que depèn de la composició i geometria de l’objecte, i c és la velocitat de la llum. Si l’objecte fos una fulla perpendicular a la direcció del Sol, aquest CR dependria de la reflectivitat de la fulla, que podria ésser un reflector perfecte (CR = 2) o un absorbidor perfecte (CR = 1) o d’un valor intermedi.

És a partir d’aquestes equacions, que Bialy & Loeb calcular que la m/A del full hauria de ser de 9,3·10-2·CR·g·cm-2.

Aquesta m/A exigiria que el gruix de l’objecte fos entre 0,3 i 0,9 mm. Si 1I/’Oumuamua tingués una densitat de 1 g·cm-3, el gruix hauria d’ésser de 0,3 mm, i si en tingués una densitat de 3 g·cm-3 el gruix seria de 0,9 mm.

L’àrea de 1I/’Oumuamua no és coneguda, ja que dependria de l’albedo d’aquest objecte. El radi efectiu de l’objecte dependrà també de l’albedo, així com la massa dependria de l’albedo i de la reflectivitat de l’objecte.

Quanta distància podria recórrer una vela llumínica d’aquestes dimensions en l’espai interestel·lar?

Bialy & Loeb tenen en compte les estimacions sobre la composició del medi interestel·lar en termes de densitat de gas. Bàsicament el gas interestel·lar consisteix en hidrogen (protons) i heli (nuclis de dos protons i dos neutrons). Com que la ratio de pols:gas en el medi galàctic és de 1:100, n’hi ha prou amb considerar l’efecte del gas interestel·lar sobre la vela llumínica. La vela podria creuar el gas intragalàctic uns 14 kpc abans de veure’s frenada.

La pols interestel·lar, però, és rellevant pels microimpactes que produiria en la vela. En els microimpactes es produiria la fusió i evaporació de material de la vela. La taxa de col·lisions, no obstant, seria prou baixa com perquè els microimpactes produissin més aviat deformacions més que no pas una reducció de la massa (a través de les perforacions). Bialy & Loeb pensen en materials carbonacis, com el grafit o el diamant.

Però hom també ha de considerar l’estrès tensil produït per forces centrífugues o mareals. 1I/’Oumuamua té un període de rotació de 6-8 hores, que generaria una força centrífuga considerable si fos un objecte tan prim com una vela llumínica. Però els càlculs de Bialy & Loeb consideren que la majoria de materials les podrien resistir, bo i més si en les equacions s’inclou l’efecte contrarestador de l’autogravetat.

En arribar a distàncies properes al Sol, l’objecte hauria patit forces mareals de consideració, que haurien estat una altra font d’estrès tensil. Tot i que és cert que la tensió mareal pot arribar a superar la tensió rotacional en la rodalia del Sol, tampoc aquesta força hauria estat insuportable per una vela llumínica de les dimensions teoritzades per Bialy & Loeb.

Que ho pugui ésser no vol dir que ho sigui

Bialy & Loeb ens ofereixen la plausibilitat d’una vela llumínica que solqui els espais interestel·lars sense que ni la interacció al material interestel·lar ni les forces rotacionals puguin frenar-la o destruir-la en distàncies inferiors a 10 kpc. En distàncies superiors la vela llumínica restaria frenada pel medi interestel·lar, i s’hi veuria arrossegat, però la seva integritat restaria indemne per un temps pràctiament il·limitat.

És clar que, ara com ara, ningú no té una idea clara de forma de 1I/’Oumuamua. Les representacions més plausibles són les d’un esferoide extremadament oblat (en forma de plat), o extremadament oblat i allargat (en forma de cigar). Fins i tot acceptant la possibilitat d’una vela llumínica, Bialy & Loeb admeten que també podria funcionar no tan sols com un full pla, sinó també com un full corbat en diferents formes (cònica, cilíndrica, el·lipsoidal).

Ara bé, si l’acceleració extragravitacional de 1I/’Oumuamua és deguda a la pressió de la radiació solar, llavors sí que caldria pensar que és un objecte interestel·lar prim d’una natura fins ara desconeguda. Aquests materials prims podrien originar-se de manera natural en el medi interestel·lar o en discs protoplanetaris?

Bialy & Loeb, assumint aquesta hipòtesi, s’inclinen però per considerar-ne l’origen artificial. Potser ‘Oumuamua és efectivament una vela llumínica. Qui sap si es tractaria de les restes d’un naufragi interestel·lar o fos senzillament el residu descartat d’un complex tecnològic avançat. Bialy & Loeb han tret aquesta idea de les veles solars dissenyades i construïdes a la Terra pel projecte IKAROS o per l’Starshot Initiative. Una civilització no gaire més avançada que la nostra podria utilitzar la tecnologia de les veles solar per al transport interplanetari de càrregues, i una de força més les podria aplicar en el transport interestel·lar.

Que 1I/’Oumuamua fos un artefacte residual d’una d’aquests vehicles de transport podria explicar la geometria atípica de l’objecte, la baixa emissió tèrmica i l’acceleració extragravitacional. Un objecte pla i d’alta reflectivitat respondria a la radiació solar.

D’acord amb les dades espectrals, 1I/’Oumuamua tindria una superfície rogenca, similar a la d’asteroides de tipus D i de cometes amb superfícies riques en materials orgànics. Bialy & Loeb diuen que aquesta coloració rogenca seria el resultat de la deposició d’una capa de pols interestel·lar damunt l’objecte.

La premsa, però, s’ha interessat més en una altra elucubració de Bialy & Loeb: que 1I/’Oumuamua sigui una sonda operativa enviada intencionalment a la Terra per una civilització alienígena. El matís respecte d’un objecte residual d’una civilització alienígena és rellevant. Si és un objecte enviat deliberadament, no caldria modificar per ell les nostres estimacions sobre la densitat de planetèssims en el medi interestel·lar.

Per descartar i altres hipòtesis fora bo tindre més observacions de 1I/’Oumuamua. Però ara l’objecte ja ha creuat l’òrbita de Júpiter i en els propers mesos creuarà l’òrbita de Saturn. Ni en els nostres telescopis més potents ja no poden obtindre imatges d’aquest objecte. Pel que fa a una missió interplanetària que s’hi acosti també s’ha tancat la finestra. L’alternativa, doncs, és intentar observar altres objectes de trajectòries hiperbòliques que arriben al nostre Sistema Solar. El Large Synoptic Survey Telescope (LSST) permetrà la cerca d’aquests objectes.

Lligams:

Could Solar Radiation Pressure Explain ‘Oumuamua’s Peculiar Acceleration. Shmuel Bialy, Abraham Loeb. arxiv.org/abs/1810.11490 (2018)

Publicat dins de 1. L'Univers | Envia un comentari

Descriuen la connexió dels components del lligament lateral fibulotalocalcanial

Anatomia: En un article a la revista Knee Surgery, Sports Traumatology, Arthroscopy, Jordi Vega, Francesc Malagelada, Maria-Cristina Manzanares Céspedes i Miki Dalmau-Pastor ofereixen una descripció del complex lligamentós fibulotalocalcaneal lateral, estructura isomètrica estabilitzadora del turmell. Vega et al. expliquen en detall els components del complex lligamentós col·latera lateral, el lligament talofibular anterior (ATFL) i el lligament calcaneofibular (CFL) i les seves relacions anatòmiques. Per fer-ho, ha realitzat un estudi anatòmic en 32 espècimens, amb una dissecció anatòmica pla per pla. Evitaren, però, de sobredisseccionar l’àrea distal immediata al fascicle ATFL inferior, per no alterar la morfologia original dels lligaments i de les fibres que els connecten. En el decurs de les dissenciacions es registraven les característiques de l’ATFL i del CFL, així com de les fibres connectores, prenent mesures en flexió plantar i dorsal. Així trobaren que en tots els espècimens l’ATFL era un lligament de dos fascicles: mentre que el fasciscle superior discorre intra-articularment, l’inferior ho fa extra-articularment. El fascicle superior mesura 19,2 mm en flexió plantar i 12,6 mm en flexió dorsal, mentre que el fascicle inferior mesura el mateix en tots dos casos (10,6 mm). Aquest fascicle inferior comparteix origen fibular amb el lligament CFL: tampoc el lligament CFL varia entre les flexions plantar i dorsal (20 mm) i tots dos connecten a través de fibres arciformes. D’aquesta manera Vega et al. conclouen que “el fascicle superior de l’ATFL és una estructura anatòmica diferenciada”, mentre que el fascicle inferior de l’ATFL i el CFL comparteixen característiques (isometria, inserció fibular comuna, interconnexió a través de fibres arciformes). Així proposen la descripció del lligament fibulotalocalcanial (LFTCL) a partir de la unitat funcional i anatòmica de l’ATFL inferior i del CFL. Les lesions en l’ATFL variaran, doncs, si afecten el fascicle superior o el fascicle inferior. Una lesió en el fascicle superior, en tant que lligament intra-articular, difícilment es guariria en cas de ruptura, i donaria com a resultat una microinestabilitat del turmell. Una lesió en el LFTCL podria sanar-se en cas de ruptura, però en l’interval conduiria a una inestabilitat del turmell. Aquesta descripció anatòmica explica que quan hi ha una lesió tant de l’ATFL i CFL, una reparació de l’ATFL (superior i inferior) pugui donar per si sola bons resultats.

La placa 355 de l’edició del 1918 de “Anatomy of the Human Body”, d’Henry Gray, ens mostra els lligaments del peu

Les bases anatòmiques de les lesions que condueixen a la inestabilitat del turmell

El traumatòleg Jordi Vega Garcia és investigador de la Unitat d’Anatomia Humana i Embriologia del Departament de Patologia i Terapèutica Experimentals de la Universitat de Barcelona. També treballa a la Unitat de Peu i Turmell de l’Hospital Quirón de Barcelona i de l’iMove de Traumatologia de la Tres Torres, de la plaça Alfons Comín de la mateixa ciutat. Alhora, és membre del Grup de Recerca i d’Estudi en Cirurgia Mini-Invasiva del Peu (GRECMIP) de Meirinhac.

El cirurgià Francesc Malagelada és membre de la Foot and Ankle Unit del Department of Trauma and Orthopaedic Surgery del Royal London Hospital.

L’anatomista Maria Cristina Manzanares Céspedes és membre de la Facultat de Ciències de la Salut de Manresa, que pertany a la Universitat de Vic i a la Universitat Central de Catalunya.

L’anatomista Miki Dalmau Pastor és membre de la Unitat d’Anatomia Humana i Embriologia de la UB, del GRECMIP de Meirinhac i de la Facultat de Ciències de la Salut de Manresa.

La tesi de Dalmau-Pastor es titulà “Anatomia clínica i quirúrgica del peu i del turmell”, i s’adreça a fornir dades per augmentar la seguretat i efectivitat de la cirúrgia ortopèdica. En esquinços de turmell es habitual trobar dany en el complex ligamentós col·lateral lateral, amb la consegüent inestabilitat articular, que pot ésser limitada (microinestabilitat) o crònica. En el cas de la inestabilitat crònica de turmell, en el 80% dels casos la base és un trencament aïllat de l’ATFL i en el 20% un trencament conjunt de l’ATFL i del CFL. En el cas de la microinestabilitat hi hauria una ruptura parcial del fascicle superior de l’ATFL.

En la descripció clàssica, el complex de lligament col·lateral lateral es format per tres lligaments:
a) l’ATFL (lligament talofibular anterior), format per dos fascicles, un de superior i un d’inferior
b) el CFL (lligament calcaniofibular), format per un sol fascicle.
c) el PTFL (lligament talofibular posterior). Aquest lligament rarament es veu afectat en casos d’esquinç, però sí de vegades en dislocacions.

Però aquesta descripció clàssica no explica algunes observacions, com el fet que lesions en les que s’afecten l’ATFL i el CFL, n’hi ha prou amb la reparació del primer com per superar la inestabilitat del turmell. Vega et al. hipotetitzaven que una millor descripció d’aquest complex seria:
a) fascicle superior de l’ATFL;
b) fascicle inferior de l’ATFL i CFL.

Trenta-dos espècimens de turmell

En aquest estudi Vega et al. utilitzaren un total de trenta-dos espècimens de cama per sota del genoll. Els espècimens procedien del Departament d’Anatomia de la Universitat de Barcelona, que és on s’hi feren les disseccions. Es tractava de mostres congelades en fresc. Cap no tenia deformitats en el peu o en el turmell o cap signe cutani de traumes, fractures o cirurgia. Cap no mostrava indicis de rigidesa o d’inestabilitat. Dos espècimens foren exclosos de l’estudi per la presència d’un fascicle ATFL d’aparença sinovialitzada.

Les disseccions les duien a terme un anatomista experimentat i un cirurgià ortopèdic especialitzat en patologies del peu i del turmell. Primer de tot, descongelaven els espècimens submergint-los en aigua a temperatura ambient. Després, obrien la pell per oferir una visió anterolateral plena de les estructures laterals del turmell. Seguia una dissecció anatòmica, pla per pla, fins a arribar a la càpsula de l’articulació anterior. En fer-ho, resseccionaven amb molta cura la càpsula per exposar els lligaments col·lateral laterals. Anotaven llavors la longitud (distància entre la inserció proximal i la distal), amplada (mesurada en el punt mitjà de l’àrea insercional) i nombre dels fascicles d’ATFL i de CFL, així com la presència de fibres connectores entre aquests lligaments. Aquests valors els obtenien en condicions de flexió plantar i de flexió dorsal del turmell. Les mesures es prenien amb un regle electrònic: cada observador anotava la seva mesura i se’n feia la mitjana.

De les variables contínues obtingudes se’n comprovà la distribució normal amb el test de Kolmogorov-Smirnov. Totes ho foren. Les diferències entre les distàncies de flexió plantar i de flexió dorsal s’analitzen amb tests de t d’Student.

Mides i connexions

Finalment, doncs, es tingueren en consideració 30 espècimens, 16 masculins i 14 femenins, 13 de cama dreta i 17 de cama esquerra. Les edats anaven de 42 a 89 anys, amb una mediana de 70,6.

En tots els espècimens, l’ATFL s’observava com un lligament de dos fascicles. El fascicle superior de l’ATFL era una estructura intra-articular. L’inferior era extra-articular en tots els casos, però en contacte estret amb la part lateral de la càpsula articular subtalar, que n’era zona d’inserció. En tots els casos es veia una separació nítida entre els dos fascicles, que era plena de teixit fibrós adipós, i solcada per un artèria de petit diàmetre. Els dos fascicles de l’ATFL tenien orígens fibulars diferents: el superior s’inseria just per sota la inserció distal del lligament tibiofibular anterior. L’ATFL inferior s’insereix en el mateix lloc que el CFL: l’aspecte anterior del mal·leol lateral, a prop de la punta de la fíbula, i just per sota de la inserció de l’ATFL superior.

La distància mediana de l’ATFL superior era de 19,2 mm en flexió plantar i de 12,6 mm en flexió dorsal. En flexió dorsal, el fascicle té un aspecte laxe, i en flexió plantar es tensa.

La distància mediana de l’ATFL inferior és de 10,6 mm tant en flexió plantar com dorsal. La distància mediana del CFL és 20,1 mm en flexió plantar i de 19,9 en flexió dorsal, però no hi ha diferències estatística entre totes dues mesures. L’ATFL inferior i el CFL connecten a través de fibres arciformes, de natura lligamentosa. Aquestes fibres arciformes tenen una longitud mediana de 6,4 mm, i cobreixen la part posterior de l’ATFL inferior, sense arribar a la inseció talar.

El lligament fibulotalocalcanial lateral

Vega et al. proposen el nom de complex lligamentós fibulotalocalcanial (LFTCL) para la unitat funcional i anatòmica formada pel fascicle inferior de l’ATFL i del CFL. Alhora, remarquen el caràcter intra-articular de l’ATFL.

La descripció actual es fonamenta sobretot en els diferents graus dels esquinç per inversió del turmell:
– en els casos més freqüents sols es danya l’ATFL, i especialment el fascicle superior.
– en els casos més greus, quan la força de deformació, és més elevada, es danya tant l’ATFL com el CFL. El resultat és una inestabilitat mecànica del turmell.
– quan l’energia de la lesió és prou contínua, hi ha un triple trencament de ATFL, CFL i PTFL. El resultat és una dislocació.

La descripció que ofereixen Vega et al. explicaria els efectes de les lesions en termes de “microinestabilitat” (ruptura de l’ATFL superior) i “inestabilitat mecànica” (ruptura de l’ATFL inferior i del CFL). Alhora, també explicaria com la inestabilitat mecànica es pot superar amb la recuperació de l’ATFL encara que el CFL continuï danyat.

Que l’ATFL superior sigui intraarticular, fa hipotesitzar a Vega et al. que una ruptura d’aquest fascicle no pugui sanar-se per ella mateixa. Aquesta lesió pot provocar una microinestabilitat continuada que augmenti el risc de recurrència d’esquinç o la formació de lesions intra-articulars. Vega et al., doncs, a la llum de les seves descobertes anatòmiques fan propostes rellevants clínicament, tant pel que fa al diagnòstic com a les intervencions terapèutiques relacionades amb lesions de turmell.

Lligams:

The lateral fibulotalocalcaneal ligament complex: an ankle stabilizing isometric structure. Jordi Vega, Francesc Malagelada, Maria-Cristina Manzanares Céspedes, Miki Dalmau-Pastor. Knee Surg. Sports Traumatol. Arthrosc. doi: 10.1007/s00167-018-5188-8 (2018).

Publicat dins de 4. L'Animal | Envia un comentari

L’eradicació del VIH-1 pel transplantament al·logènic de cèl·lules mare hematopoiètiques

Virologia: Investigadors com Maria Salgado, Bonaventura Clotet o Javier Martínez-Picado fan part de l’IciStem, un projecte col·laboratiu per investigar el potencial d’una cura de la infecció pel virus de la immunodeficiència humana (VIH) del transplantament al·logènic de cèl·lules hematopoiètiques. Aquest transplantament és indicat en algunes malalties hematològiques. Pacients infectats pel VIH que pateixen algunes d’aquestes malalties hematològiques han experimentat, després del transplantament, una reducció radical dels reservoris de VIH, fins el punt de no haver de necessitar ja la teràpia antiretroviral. Fins i tot en un cas hi ha una seroreversió, és a dir que han desaparegut no tan sols el virus sinó també els anticossos anti-VIH. Els investigadors de l’IciStem són conscients que aquesta teràpia no es pot generalitzar a tots els infectats amb VIH, però sí pensen que estudiar els mecanismes subjacents a aquesta reducció pot ajudar al disseny de teràpies curatives que sí puguin generalitzar-se. En un article a Annals of Internal Medicine, encapçalat per Maria Salgado i Mi Kwon, exposen els mecanismes d’aquesta reducció de reservoris virals.

Electrografia de 1984 d’un limfòcit (superfície colorejada de blau) del qual emergeixen partícules d’HIV-1 (colorejades de verd)

La cohort observacional d’IciStem

Un transplantament al·logènic de cèl·lules mare hematopoiètiques suposa en principi la substitució dels diferents llinatges cel·lulars sanguinis. El virus de la immunodeficiència humana, tant l’HIV-1 com l’HIV-2, infecten cèl·lules que expressen a la membrana el receptor CD4, fonamentalment, limfòcits T auxiliars (limfòcits TH CD4+). Aquests limfòcits T tenen un paper essencial en el sistema immunitari específic, tant en la resposta cel·lular (cèl·lules citotòxiques) com en l’humoral (anticossos), i és la depleció d’aquest tipus cel·lular en cas d’infecció per VIH la que condueix eventualment a l’anomenada síndrome d’immunodeficiència adquirida (SIDA). La SIDA es tracta actualment amb fàrmacs antiretrovirals, però aquests no poden més que contindre la virèmia i la infecció, i no pas guarir-la. Un transplantament al·logènic de cèl·lules totipotencials hematopoiètiques rentaria els reservoris virals, i això explicaria els casos observats de reducció radical de reservoris de HIV-1 que formen la cohort observacional d’IciStem.

Ara bé, en aquesta reducció semblen implicats diversos mecanismes, que els investigadors d’IciStem no consideren completament elucidats. En la cohort observacional d’IciStem participen pacients atesos en diferents centres europeus. Concretament, en aquest estudi de Salgado et al. inclouen sis casos. Tots sis eren pacients infectats per VIH, tractats amb antiretrovirals i que, per una malaltia hematològica no relacionada, es van haver de sotmetre a un transplantament al·logènic amb cèl·lules totipotencials hematopoiètiques que expressaven CCR5. El virus infecta limfòcits a través dels receptors CD4, però també necessita per aquesta infecció, com a co-receptors, els CCR5.

Els pacients foren inclosos en aquest estudis dos anys després d’haver rebut el dit transplantament. Se’ls ha fet un seguiment a través de diferents mesures:
– en mostres de sang s’ha analitzat la càrrega viral en termes d’ADN, d’ARN i mitjançant un assaig de creixement viral quantitatiu.
– en mostres de ganglis limfàtics, moll de l’os i fluid cerebrospinal s’analitzà la presència d’ADN viral, com a representatiu de reservoris no-sanguinis.
– fraccions de cèl·lules sanguínies foren inoculades en un model humanitzat de ratolí, per tal de detectar-hi la replicació de VIH en el reservori sanguini.
– en mostres de plasma es mesuraren els anticossos específics anti-VIH.

La reducció dels reservoris virals

Salgado et al. són conscients que el nombre d’individus de l’estudi és massa baix. Però, de totes maneres, poden extraure una sèrie de conclusions. Dels 6 pacients, n’hi ha cinc que, ja en el primer any després de transplantament, presentaven una completa substitució de la població de limfòcits T, és a dir que els seus limfòcits T tenien origen en el transplantament. En aquests cinc pacients ja no es detectava la presència d’ADN proviral de VIH ni en sang ni en teixits. El bioassaig in vitro no detectava tampoc la presència de virus competents pel que fa a la replicació (la tècnica permet detectar fins 0,006 unitats infeccions per cada milió de cèl·lules).

El pacient que no mostrava una substitució completa en el primer any de la població de limfòcits T havia rebut un transplantament de cèl·lules mare de cordó umbilical amb globulina anti-timòcits. Fou aquest pacient l’únic dels sis que mostrava encara una virèmia detectable.

El bioassaig en ratolí, consistent en l’administració de limfòcits T CD4+ a ratolins immunodeprimits no es manifestava en la presència de VIH.

En els 5 casos de substitució completa de limfòcits T els nivells d’anticossos anti-HIV disminuïa al llarg del temps, i en 1 d’ells els nivells d’anticossos arribaven a zero: és a dir que el pacient deixava d’ésser seropositiu.

El curs posterior al transplantament depèn de factors com la font de cèl·lules mare, el condicionament i la coexistència de limfòcits originaris i transplantats. Però, en els sis casos estudiats, hi ha una profunda reducció a llarg termini dels reservoris de VIH.

Lligams:

Mechanisms That Contribute to a Profound Reduction of the HIV-1 Reservoir After Allogeneic Stem Cell Transplant. Maria Salgado; Mi Kwon; Cristina Gálvez; Jon Badiola; Monique Nijhuis; Alessandra Bandera; Pascual Balsalobre; Pilar Miralles; Ismael Buño; Carolina Martinez-Laperche; Cristina Vilaplana; Manuel Jurado; Bonaventura Clotet; Annemarie Wensing; Javier Martinez-Picado; Jose Luis Diez-Martin; for the IciStem Consortium. Ann. Intern Med. 10.7326/M18-0759 (2018).

IciStem Consortium.

The American Foundation of AIDS Research, finançadora principal d’aquesta recerca.

Publicat dins de 3. La Vida | Envia un comentari

Innovació, clima i creixement econòmic (William D. Nordhaus, Paul M. Romer; Premi Nobel d’Economia, 2018)

La Reial Acadèmia Sueca de Ciència ha comunicat la concessió del Premi del Banc Reial Suec en Ciències Econòmiques en memòria d’Alfred Nobel d’enguany a William D. Nordhaus i Paul M. Romer. Nordhaus l’ha rebut “per integrar el canvi climàtic en l’anàlisi macroeconòmica de llarg termini”. Romer, “per integrar les innovacions tecnològiques en l’anàlisi macroeconòmica de llarg termini”.

William D. Nordhaus: macroeconomia i canvi climàtic

William D. Nordhaus (*Albuquerque, Nou Mèxic, 31.5.1941) es graduà a la Yale University el 1963, després d’haver fet una estada a l’Institut d’Etudes Politiques (1962). Es va doctorar al MIT en el 1967, sota la supervisió de Robert Solow. Sota el mestratge de Solow s’interessà en els models d’endogenització dels externalitats dels sistemes econòmics. El 1967, tornà a Yale, on esdevingué professor d’economia. Fou un dels membres del Consell d’Assessors Econòmics entre el 1977 i el 1979.

En els anys 1970, Nordhaus estudià els aspectes econòmics de l’escalfament global derivat del consum de combustibles fòssils. A mitjan dels 1990, creà un “model de valoració integrat“, que contemplava factors físics, químics i econòmics. Aquest model serví al desenvolupament de les taxes de carboni i altres intervencions per pal·liar el canvi climàtic.

Paul M. Romer: macroeconomia i innovació

Paul M. Romer (*Denver, Colorado, 1955) es va graduar a la Phillips Exeter Academy. Després d’estudiar al MIT i a la Queen’s University, a la University of Chicago es va graduar en matemàtiques (1977), i va fer el mestratge (1978) i el doctorat (1983) en economia. Fou professor a Berkeley, a Chicago i a Rochester. En el 2001, deixà l’acadèmia per fundar Aplia, companyia de creació de problemes i qüestionaris per a estudiants universitaris. Entre octubre el 2016 i gener del 2018 fou l’economista en cap del Banc Mundial. Actualment, és professor a la NYU Stern School of Business.

Romer treballà sobre com el coneixement actua com a motor del creixement econòmic a llarg termini. Alhora, però, els agents econòmics, d’acord amb les condicions del mercat, prenen decisions que determinaran la introducció de noves idees i de noves tecnologies, tema al qual dedicà la tesi doctoral, sota la supervisió de José Scheinkman i Robert Lucas Jr. Es tractava de construir representacions matemàtiques d’economies en les quals el canvi tecnològic s’entengués com a resultat d’accions intencionals d’agents econòmics, és a dir dels seus investiments en recerca i desenvolupament. A partir del 1990, Romer enuncià una teoria de creixement endogen. Aquesta teoria contempla l’especificitat de les idees en una economia de mercat, que no poden reduir-se a un bé més. La teoria del creixement endogen ha inspirat polítiques adreçades al foment de la innovació.

Lligams:

Economic Growth and Climate: The Carbon Dioxide Problem. William Nordhaus. American Economic Review 67: 341-346 (1977).

Endogenous Technological Change. Paul Romer. Journal of Political Economy 98: S71-102 (1990).

Managing the Global Commons: The Economics of Global Change. William D. Nordhaus. Cambridge, MA: MIT Press (1994).

Publicat dins de 6. La Civilització | Envia un comentari

Denis Mukwege i Nadia Murad, Premi Nobel de la Pau 2018

El Comitè Nobel Noruec ha anunciat la concessió del Premi Nobel de la Pau del 2018 a Denis Mukwege i Nadia Murad “pels llurs esforços per posar fi a l’ús de la violència sexual com a armada de guerra i de conflicte armat“. El comitè recorda que fa 20 anys s’aprovà l’Estatut de Roma, normativa del Tribunal Penal Internacional, i que fa 10 anys el Consell de Seguretat de Nacions Unides aprovà la resolució 1820, que establia com a crim guerra i amenaça a la pau i seguretat internacionals l’ús de violència sexual com a armada de guerra i conflicte armat

Denis Mukwege

Denis Mukengere Mukwege (*Costermansville, Kivu, Congo, 1.3.1955) és diplomà en medicina a la Facultat de Burundi. S’especialitzà en ginecologia a la Universitat d’Angers. A Angers cofundà l’Esther Solidarité France-Kivu. El 1989 tornà al Congo per assumir la direcció mèdica de l’hospital de Lemera.

En el 1996, l’Hospital de Lemera fou destruït durant la guerra, i Mukwege es refugià a Nairobi. En el 2008 participà en la fundació de l’Hospital Panzi, de Bukavu, on han estat tractades 85000 dones, el 60% de les quals han patit violència sexual, molt sovint lligada a conflictes armats.

El 25 d’octubre del 2012, la casa de Mukwege fou assaltada per quatre homes armats. Llavors ell era fora de casa, però sí hi eren les filles, que foren retingudes com a hostatges. En tornar a casa, un dels guardes de Mukwege intervingué i fou mort pels assaltants. Davant d’aquest fet, Mukwege s’exilià a Europa, i no tornà a Bukavu fins el 14 de gener del 2013.

En el 2015 es doctorà en ciències mèdiques a la Universitat Lliure de Brussel·les, amb un tesi titulada “Étiologie, classification et traitement des fístules traumàtiques uro-génitales et génito-digestives basses dans l’est de la RDC”.

Nadia Murad

Nadia Murad (*Kojo, 1993) va nàixer al si d’una família iazidita. L’agost del 2014, Kojo i altres poblacions del districte de Sinjar patiren atacs sistemàtics del Daesh adreçats contra la població iazidita. A Kojo assassinaren a centenars de persones, i capturaren com a esclaves sexuals les dones joves, incloses menors. Nadia Murad, llavors de 21 anys, era una d’elles i fou sotmesa a abusos sexuals i l’amenaçaren de mort si no renegava de la fe iazidita. Es calcula que 3000 noies i dones iazidites patiren aquests abusos.

Després de tres mesos de captivitat, Murad aconseguí de fugir. En lloc segur denuncià obertament els abusos patits per ella i per la població iazidita. En el 2016 fou designada Ambaixadora de Bona Voluntat de Nacions Unides per la Dignitat de Supervivents de Tràfic Humà.

Publicat dins de 6. La Civilització | Envia un comentari

L’evolució dirigida d’enzims i anticossos (Frances H. Arnold, George P. Smith, Gregory P. Winter; Premi Nobel de Química 2018)

Bioquímica: La Reial Acadèmia Sueca de Ciències ha fet públic els noms dels guardonats amb el Premi Nobel de Química del 2018. L’ha repartit en dues meitats de 4,5 milions de corones sueques cadascuna. La primera meitat ha correspost a Frances H. Arnold “per l’evolució dirigida d’enzims“. La segona meitat se la repartiran George P. Smith i Sir Gregory P. Winter “per l’exposició en bacteriòfags de pèptids i anticossos“.

Frances H. Arnold

Frances H. Arnold (*Edgewood, Pennsylvania, 25.7.1956) es graduà en enginyeria mecànica i aeroespacial a la Princeton University (1979). Es doctorà en enginyeria química a la University of California, a Berkeley, el 1985. És professora d’enginyeria química, bioenginyeria i bioquímica del California Institute of Technology, a Pasadena.

George P. Smith

George P. Smith (*Norwalk, Connecticut, 10.3.1941) es graduà en biologia al Haverford College. Es doctorà en bacteriologia i immunologia a la Harvard University el 1970, amb Edgar Haber de supervisor. Després d’una estada a la University of Wisconsin, esdevingué professor de ciències biològiques a la University of Missouri, a Columbia.

Gregory P. Winter

Gregory P. Winter (*Leicester, 14.4.1951) es graduà en ciències naturals a la University of Cambridge (1973). En el mateix centre es doctorà el 1977, amb una tesi sobre la seqüència aminoacídica de la triptofanil-ARNt-sintetasa de Bacillus stearo-thermophilus, supervisada per Brian S. Hartley i George Brownlee. Desenvolupà la seva carrera en el MRC Laboratory of Molecular Biology, a Cambridge. En el 1989 fundà la Cambridge Antibody Technology, que havia de traslladar els seus estudis sobre humanització d’anticossos monoclonals i sobre l’ús del fag filamentós com a vector d’expressió de fragments d’anticossos.

L’evolució dirigida d’enzims

En el 1984, Manfred Eigen teoritzà sobre un procediment d’evolució dirigida d’enzims. La combinació de genoteques, de diverses generacions de mutagènesi i de cribatge es constituïa en una “màquina evolutiva” per a l’optimització d’enzims d’acord amb un criteri preestablert. En el 1993, Chen & Arnold combinaren quatre rondes de mutagènesi aleatòria (amb l’ús de polimerasa de baixa fidelitat) i cribatge d’activitat per aconseguir una variant de la proteasa subtilisina E capaç de funcionar a concentracions elevades (60%) de dimetilformamida (Chen & Arnold, 1993) amb una activitat 256 vegades superior a la de l’enzim originari.

El laboratori d’Arnold aprofundí en les diverses passes d’aquesta tècnica d’evolució dirigida d’enzims:
1) identificar l’enzim adient per a la tasca que hom cerca.
2) construir una genoteca que cobreixi les parts més essencials del gen d’aquest enzim.
3) identificar els criteris de selecció que conduir a un enzim òptim per a la tasca que hom cerca.
4) a partir de les seqüències que compleixen millor els criteris de selecció, crear una nova genoteca que cobreixi parts addicionals del gen d’estudi.
5) establiment de criteris de selecció més exigents, i d’ací tornar a la passa 4 els cicles que convingui.

L’evolució dirigida d’enzims, com tot procés evolutiu, té com a matèria primera la variabilitat. El grup d’Arnold, doncs, va haver de dedicar esforços a tècniques de mutagènesi, fossin aleatòries o selectives. Miyazaki & Arnold (1999) constataren la dificultat que la mutagènesi puntual pogués produir substitucions aminoacídiques, com Pro/Ala, Pro/Val, Leu/Val o Trp/Ser, que requereixen dues o tres substitucions nucleotídiques en el codó corresponents.

Esquema l’evolució dirigida (cicle exterior) comparada amb l’evolució natural (cicle interior). La variabilitat és introduïda amb l’ús d’una polimerasa de baixa fidelitat, que produeix una mutagènesi aleatòria. La selecció es fa en un sistema d’expressió adequat, capaç de discriminar positivament les variants més favorables a la finalitat que es persegueix. Les variants desitjades seran les que entraran en un nova generació de mutagènesi, mentre que es descarten les altres

Un altre element de la tècnica és el procés selectiu. El grup d’Arnold treballà particularment en microorganismes que depenien per a la supervivència en un medi extrem del desenvolupament de l’activitat enzimàtica d’interès. Per exemple, per a l’obtenció d’una para-nitrobenzil-esterasa per a solvents aquo-orgànics, el cribatge de mutants es feien a través de la capacitat de metabolitzar l’antibiòtic loracarbef (Moore & Arnold, 1996). Per a l’obtenció d’una para-nitrobenzil-esterasa termostable, el cribatge es feia per la supervivència a diferents temperatures en un medi amb loracarbef (Giver et al., 1998)

L’evolució dirigida permeté a Giver et al., 1998 d’aconseguir, després de sis rondes de mutagènesi aleatòria, p-nitrobenzil-esterases amb una major termostabilitat. Així, mentre si l’enzim originaria perdia fortament activitat a temperatures superiors a 50ºC, la variant 6sF9, funcionava amb una alta activitat específica fins i tot a 60ºC

El grup d’Arnold ha demostrat que no tan sols hom pot aconseguir enzims que realitzen les seves funcions a temperatures o a altres condicions diferents de les naturals, sinó que també es pot aconseguir modificar la mateixa activitat enzimàtica. Herger et al. (2016) aconseguiren fer evolucionar la triptòfan-sintasa de Pyrococcus furiosus perquè generés un aminoàcid diferent, el beta-metil-triptòfan. Kan et al. (2016) feren evolucionar l’activitat d’inserció de carbè del citocrom c de Rhodothermus marinus fins a adquirir la capacitat de formar enllaços C-Si, amb una eficiència quinze vegades superior a la de catalitzadors industrials.

En l’actualitat, l’evolució dirigida d’enzims s’empra en el desenvolupament de biocatalitzadors més resistents o que realitzin noves funcions.

L’exposició en bacteriòfags de pèptids i anticossos

En el 1985, George P. Smith desenvolupà l’ús del bacteriòfag filamentós f1 com a vector d’expressió: els productes peptídics dels gens clonats eren expressats en la superfície de la partícula vírica en una proteïna de fusió (Smith, 1985). Això simplificava els protocols de cribatge de genoteques, ja que els productes gènics podien ésser identificats per la seva unió específica a receptors o a anticossos (Parmley & Smith, 1988).

Esquema d’una partícula vírica d’un fag filamentós (“Inovirus”). Aquests bacteriòfags infecten enterobacteris. En l’esquema s’assenyala de color blau la proteïna de coberta pIII, que és l’habitualment utilitzada en les tècniques d’exposició. A més tenim la pVI (bruna), pVII (vermella), pVIII (verda) i pIX (fúcsia). En porpre s’indica l’ADN monocatenari que constitueix el genoma d’aquest tipus de virus

Aquests vectors d’expressió foren emprats aviat per estudiar antígens de Plasmodium falciparum, l’agent de la malària. Scott & Smith (1990) mostraren que aquest sistema es podia fer servir per confegir “llibreries d’epitops”, és a dir llibreries de pèptids amb les quals es podia assajar l’especificitat d’anticossos. De manera semblant, les llibreries de pèptids podien servir per a la identificació de fàrmacs que s’uneixin específicament a seqüències aminoacídiques.

Protocol de selecció clonal en un fag filamentós com a vector d’expressió. La introducció d’una seqüència genètica en el genoma del fag filamentós fa que la seqüència peptídica corresponent sigui expressada en una de les proteïnes de càpside viral. Amb un ligand adequat hom pot seleccionar els fags filamentosos que expressen el pèptid desitjat amb un cicle de rentats

Un raonament invers va fer el grup de Gregory P. Winter, que utilitzà el fag filamentós com a vector d’expressió dels gens V d’anticossos (McCafferty et al., 1990). Mostraren que les seqüències proteiques expressades retenien l’especificitat de l’anticòs originari. Això obria la porta al disseny d’anticossos de major afinitat per a ligands específics.

La combinació de la tècnica d’exposició en bacteriòfags filamentosos i l’evolució dirigida s’ha utilitzat en el desenvolupament d’anticossos sintètics amb finalitats farmacològiques. El primer fàrmac aprovat que s’obtingué per aquesta via fou el adalimumab, un anticòs bloquejant de TNFα, que és efectiu en diferents malalties inflamatòries. Qui desenvolupà l’adalimumab fou la Cambridge Antibody Technology, de Greg Winter

Lligams:

Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. G. P. Smith Science 228: 1315-1317 (1985)

Antibody-selectable filamentous fd phage vectors: affinity purification of target genes. Stephen F. Parmley, George P. Smith. Gene 73: 305-318 (1988)

Searching for peptide ligands with an epitope library. J. K. Scott, G. P. Smith. Science 249: 386-390 (1990).

Phage antibodies: filamentous phage displaying antibody variable domains. John McCafferty, Andrew D. Griffiths, Greg Winter, David J. Chiswell. Nature 348: 552-554.

Tuning the activity of an enzyme for unusual environments: sequential random mutagenesis of subtilisin E for catalysis in dimethylformamide. K. Chen, F. H. Arnold. PNAS 90: 5618-5622 (1993)

Directed evolution of a para-nitrobenzyl esterase for aqueous-organic solvents. Jeffrey C. Moore, Frances H. Arnold. Nat. Biotechnol. 14: 458-467 (1996).

Directed evolution of a thermostable esterase. Lori Giver, Anne Gershenson, Per-Ola Freskgard, and Frances H. Arnold. PNAS 95: 1280-12813 (1998).

Exploring nonnatural evolutionary pathways by saturation mutagenesis: rapid improvement of protein function. K. Miyazaki, F. H. Arnold. J. Mol. Evol. 49: 716-720 (1999)

Synthesis of β-Branched Tryptophan Analogues Using an Engineered Subunit of Tryptophan Synthase. Michael Herger, Paul van Roye, David K. Romney, Sabine Brinkmann-Chen, Andrew R. Buller, Frances H. Arnold. J. Am. Chem. Soc. 138: 8388-8391 (2016).

Directed evolution of cytochrome c for carbon–silicon bond formation: Bringing silicon to life. S. B. Jennifer Kan, Russell D. Lewis, Kai Chen, Frances H. Arnold 354: 1048-1051 (2016)

Publicat dins de 6. La Civilització | Envia un comentari