Bon any 2019, replicants!

Bon any 2019! Sí. És cert que no tenim colònies espacials llevat d’una atrotinada estació orbital a 300 km. És cert que no tenim replicants, i que fins i tot una modesta cirurgia genètica desencadena rius de tinta, però no ens podem queixar pel que fa a les telecomunicacions. A més tenim un aire relativament net, i xamullant l’anglès ens podem fer entendre pels barris de totes les ciutats globals. Així que no ens toca patir en aquest any 2019 pel secretisme de la Tyrell Corporation o pels mètodes expeditius dels “blade runner”, sinó més aviat pel secretisme dels grans gegants de les tecnologies de la comunicació i de la interactivitat, i pels mètodes expeditius dels “trolls” de les xarxes socials. Com que els anys comencen com un full blanc, tan sols tenim anotades algunes efemèrides. Enguany s’escaurà el Centenari de revolucions (espartaquista, consellista, etc.) i de reaccions, commemorant la fundació dels “Fasci di combattimento” i l’entrada d’Adolf Hitler en el Partit Obrer Alemany. També s’escaurà, el 10 d’agost, el Cinquè Centenari de la sortida de l’expedició de Magalhães de Sevilla que havia d’ésser la primera circumnavegació (completada el 1522).

Així veia el pinzell de Nicolas Poussin (1594-1665) en 1627 “La Mort de Germanicus”. Enguany commemorarem el Bimil·lenari d’aquella mort, escaiguda a Antioquia el 10 d’agost del Consolat de M. Iunius Silanus Torquatus i L. Norbanis Balbus. Caius Iulius Caesar Germanicus tenia llavors 32 anys. Nascut com a Nero Claudius Drusus, havia estat introduït a la família Júlia l’any 6 d.C., en ésser adoptat pel seu oncle patern, Tiberi, al seu torn adoptat per l’emperador César August. Després de la mort d’August, Germànic havia estat considerat el successor natural de Tiberi. El nom de Germànic l’havia rebut del seu pare biològic, premiat així per les seves campanyes a Germania, però ell mateix feu mèrits per rebre aquest títol durant diverses campanyes. La seva mort fou atribuïda a una conspiració desencadenada contra els seus intents de reorganitzar les províncies orientals. A banda de la seva carrera militar i política, tingué temps de compondre versos astronòmics com “Aratea

2019: Any Internacional de la Taula Periòdica dels Elements Químics

Logo de l’Any Internacional de la Taula Periòdica dels Elements. El logo representa Mendeleev com a autor de la taula periòdica dels elements químics. Ell mateix ha estat homenatjat a través de l’element 101. En el logo també s’inclouen els quatre elements bàsics de la matèria orgànica: hidrogen (1), carboni (6), nitrogen (7) i oxigen (8).

El 20 de desembre del 2017, l’Assemblea General de Nacions Unides proclamà l’any 2019 com l’Any Internacional de la Taula Periòdica dels Elements Químics. Es tracta de reconèixer la taula periòdica d’elements químics i les seves aplicacions, alhora que hom recorda la tasca de la química en la promoció del desenvolupament sostenibles i les solucions als reptes existents en els àmbits de l’energia, l’educació, l’agricultura i la salut.

La tria del 2019 per celebrar aquesta commemoració s’associà al 150è aniversari de la proposta de sistema periòdica feta per Dmitri Mendeleev. S’uneix també al fet que el 28 de juliol d’enguany es commemora el centenari de la Unió Internacional de Química Pura i Aplicada (IUPAC). La cerimònia inaugural de l’IYPT2019 tindrà lloc a París el 29 de gener.

En el 1869, el sistema periòdic de Mendeleev provava d’oferir una explicació subjacent a la proliferació de descripcions de “nous elements químics”. Aviat la mateixa taula seria utilitzada per hipotetitzar les propietats d’elements químics encara desconeguts. En les dècades posteriors hom entendria la base física de la taula periòdica, de manera que la multiplicitat d’àtoms fou reduïda a un nombre relativament senzill de partícules subatòmiques: protons, neutrons i electrons. D’aquesta forma, la configuració electrònica dels àtoms explicava l’estructuració de la taula periòdica.

En l’actualitat s’han descrit tots els elements químics fins al setè període. Cadascun d’aquests 118 elements ha rebut un nom i un símbol format per una o dues lletres (la primera de les quals en majúscula). D’esquerra a dreta tenim metalls alcalins, metalls alcalino-terris, metalls lantànids, metalls actínids, metalls de transició, metalls de post-transició, metal·loids, no-metalls reactius i gasos nobles. La taula ordena els elements d’acord amb propietats com ara l’energia d’ionització i el radi atòmic.

2019: Any Internacional de les Llengües Indígenes

Per resolució de l’Assemblea General de Nacions Unides (A/RES/71/178) del 19 de desembre del 2016, en el marc de la defensa dels drets dels pobles indígenes, es declarà l’any 2019 com Any Internacional de les Llengües Indígenes.

Es calcula que de les 6700 llengües que es parlen en el món, el 40% es troben en perill de desaparèixer. Moltes d’elles són llengües de pobles indígenes, i el retrocés lingüística implica tota una amenaça a les cultures i sistemes de coneixement dels quals són vehicle. Les llengües indígenes han d’ésser considerades com un recurs estratègic de desenvolupament, construcció de la pau i reconciliació.

2019: Any Internacional de la Moderació

El 8 de desembre del 2017, l’Assemblea General de les Nacions Unides aprovà una resolució en la que es declarava l’any 2019 com l’Any Internacional de la Moderació (A/RES/72/129).

La moderació és considerada un valor important i una estratègia de confrontació a l’extremisme violent, en el tractament del terrorisme i en la promoció del diàleg, el respecte mutu i l’entesa. Així la moderació es considera un reforçament dels tres pilars de les Nacions Unides: 1) pau i seguretat; 2) desenvolupament; i 3) drets humans.

La moderació fomenta la inclusivitat, el respecte a la diversitat, l’entesa, la tolerància i la cooperació entre persones de diferents cultures, religions i creences.

Des d’aquest enfocament, un dels protagonistes de l’Any Internacional de la Moderació serà l’Aliança de Civilitzacions (UNAOC).

L’any 2019 gregorià i els altres

L’any 2019 AD és un any comú (de 365 dies), amb lletra dominal F (car comença en dimarts). Arrencarà en la data juliana de 2458484,5 i en el segon Unix de 1546300800. En el compte llarg maia l’any 2019 arrenca el 13.0.6.2.2. En termes de l’ISO 8601 la primera setmana del 2018 arrenca el dilluns 31 desembre del 2018, i la darrera setmana, la que farà 52, conclourà el diumenge 29 de desembre del 2019. La Lluna començarà l’any cap a quart minvant, amb 23-24 dies d’edat. El Diumenge de Pasqua tindrà lloc el 21 d’abril. Per discrepàncies en el comptatge de l’edat lunar, la Pasqua Juliana s’escaurà el diumenge següent, el 28 d’abril. La Pasqua Jueva (15 de Nisan) començarà el 19 d’abril.

L’any 2019 és l’any 2057 de l’era, l’any 2772 de la fundació de Roma i l’any 3185 de la Discòrdia. L’Any Nou Lunar s’escaurà el 5 de febrer, quan entrarem en el signe del porc de terra (己亥). L’equinocci vernal del 2019 (20 de març) marcarà l’inici de l’any 176 de l’era bahá’í. L’equinocci autumnal del 2019 (23 de setembre) suposarà l’inici de l’any 7528 del món segons el còmput bizantí, l’any 2012 de l’encarnació segons el còmput etíop, l’any 1736 dels màrtirs segons el còmput alexandrí i l’any 228 de la república francesa. La lluna nova de setembre (dia 1) anunciarà els inicis de l’any 5780 del món segons el còmput hebreu i de l’any 1441 de l’hègira. En general, l’any 2019 es correspon a l’any 6769 de la fundació d’Assur, el 4352 de l’era coreana, el 2969 de l’era amazic, el 2563 de l’era budista, el 1953 de l’era javanesa, el 1941 de l’era balinesa, el 1468 de l’era armeniana (ԹՎ ՌՆԿԸ), el 1426 de l’era bengalí, el 1381 de l’era birmana, el 1020 de l’era igbo, el 551 de l’era sikh, el 108 de l’era iutxe i de l’era republicana xinesa. També serà, en principi, l’any 31 i últim de l’era Heisei (平成31年) en el decurs del qual hi haurà l’abdicació de l’actual emperador (prevista pel 30 d’abril).

L’any 2019 astronòmic

El periheli d’enguany, màxim acostament de la Terra al Sol, tindrà lloc el 3 de gener a les 05:20UTC (0,98330 UA). L’afeli, màxim allunyament, es produirà el 4 de juliol a les 22:11UTC (1,017 UA).

Els equinoccis seran el 20 de març a les 21:58UTC i el 23 de setembre a les 07:50UTC. Els solsticis es produiran el 21 de juny a les 15:54UTC i el 22 de desembre a les 04:19UTC.

Tindrem lluna nova el 6 de gener, el 4 de febrer, el 6 de març, el 5 d’abril, el 4 de maig, el 3 de juny, el 2 de juliol, l’1 d’agost, el 30 d’agost, el 28 de setembre, el 28 d’octubre, el 26 de novembre i el 26 de desembre. És a dir, que serà un any de 13 novilunis.

El 2019 serà un any de tres eclipsis solars, cap d’ells visible des de Barcelona:
– el 6 de gener del 2019, amb màxim a les 01:42:38UTC a 67,4°N 153,6°E. Serà un eclipsi parcial visible a l’Àsia Nord-Oriental i al Pacífic Nord. És l’eclipsi 58 dels 70 inclosos en el saros 122.
– el 2 de juliol del 2019, amb màxima a les 19:24:08UTC a 17,4°S 109,0°W (4 minuts i 33 segons de durada). Serà un eclipsi total en el Pacífic Sud, a Xile, en ciutat com La Serena, Coquimbo i La Higuera, i a Argentina, en ciutats com San Juan i Río Cuarto. És l’eclipsi 58 dels 82 inclosos en el saros 127.
– el 26 de desembre del 2019, amb màxima a les 05:18:53UTC a 1,0°N 102,3°E (3 minuts i 40 segons de durada). Serà un eclipsi anul·lar visible en ciutats com Kozhikode, Coimbatore, Jaffna, Trincomalee, Sibolga, Batam, Singapur, Singkawang i Guam. És l’eclipsi 46 dels 71 inclosos en el saros 132.

Tindrem dos eclipsis lunars, tots dos visibles des de Barcelona:
– la matinada del dilluns 21 de gener tindrà lloc un eclipsi lunar total (saros 134). A Barcelona la Lluna entrarà en la penombra a les 03:36CET, quan encara serà a una altitud de 49,6°, i entrarà a l’ombra a les 04:33CET (altitud 39,5°); la totalitat començarà a les 05:41CET (altitud 27,2°) i conclourà a les 06:43CET; la sortida de l’ombra es produirà a les 07:50CET, i quan la lluna creui l’horitzó a les 08:22CET encara ho farà en la penombra.
– la nit del 16 al 17 de juliol tindrà lloc un eclipsi lunar total (saros 139), encara que a Barcelona no passarà d’eclipsi parcial. A Barcelona la lluna sortirà a les 21:16CEST, ja en la penombra; l’eclipsi parcial començarà a les 22:01CEST (altitud 6,1°) i arribarà al màxim a les 23:30 CEST (altitud 17,3°), quan més de la meitat del disc serà cobert; la lluna sortirà de l’ombra a les 00:59CEST i de la penombra a les 02:17CEST.

Enguany també hi haurà un trànsit de Mercuri (l’anterior fou el 2016 i el proper no serà fins el 2032). Serà l’11 de novembre del 2019, i tindrà lloc des de les 12:35UTC a les 18:04UTC. A Barcelona hom el podrà veure, doncs, començar a les 13:35CET; el disc mercurià entrarà completament en el disc solar a les 13:37CET, i arribarà a col·locar-s’hi prop del centre a les 16:19CET; no obstant, com el Sol es posarà a les 17:34CET no veurem la darrera part del trànsit ni la seva conclusió.

Entre les principals conjuncions de l’any 2019 podem citar:
– el 21 de gener, a les 15:32UTC, la Lluna se situarà a 0,6° al sud del Cúmul del Pessebre.
– el 31 de gener, a les 17:36UTC, es produirà l’ocultació de Venus per la Lluna minvant.
– el 2 de febrer, a les 07:18UTC, tindrà l’ocultació de Saturn per la Lluna minvant.
– el 18 de febrer, a les 03:05UTC, la Lluna se situarà a 0,6° al sud del Cúmul del Pessebre.
– l’1 de març, a les 18:40UTC, la Lluna minvant ocultarà Saturn.
– el 17 de març, a les 13:01UTC, la Lluna se situarà a 0,5° al sud del Cúmul del Pessebre.
– el 29 de març, a les 05:11UTC, la Lluna minvant ocultarà Saturn.
– el 13 d’abril, a les 20:12UTC, la Lluna se situarà a 0,2° al sud del Cúmul del Pessebre.
– el 25 d’abril, a les 14:38UTC, la Lluna minvant ocultarà Saturn.
– l’11 de maig, a les 01:35, la Lluna creuarà el Cúmul del Pessebre.
– el 22 de maig, a les 22:25UTC, la Lluna minvant ocultarà Saturn.
– el 7 de juny, a les 07:19UTC, la Lluna se situarà a 0,2° al nord del Cúmul del Pessebre.
– el 18 de juny, a les 18UTC, Mercuri s’acostarà a 0,2° de Mart.
– el 19 de juny, a les 03:58UTC, la Lluna minvant ocultarà Saturn.
– el 4 de juliol, a les 15:02UTC, la Lluna se situarà a 0,2° al nord del Cúmul del Pessebre.
– el 13 de juliol, a les 07:06UTC, Mart se situarà a 0,4° al nord del Cúmul del Pessebre.
– el 16 de juliol, a les 07:27, la Lluna creixent ocultarà Saturn.
– el 12 d’agost, a les 10:05UTC, la Lluna creixent ocultarà Saturn.
– el 28 d’agost, a les 11:31UTC, la Lluna se situarà a 0,2° al nord del Cúmul del Pessebre.
– el 8 de setembre, a les 13:53UTC, la Lluna creixent ocultarà Saturn.
– el 24 de setembre, a les 21:15UTC, la Lluna se situarà a 0,4° al nord del Cúmul del Pessebre.
– el 5 d’octubre, a les 20:48UTC, la Lluna creixent ocultarà Saturn.
– el 22 d’octubre, a les 04:41UTC, la Lluna se situarà a 0,6° al nord del Cúmul del Pessebre.
– el 2 de novembre, a les 07:31UTC, la Lluna creixent ocultarà Saturn.
– el 18 de novembre, a les 10:11UTC, la Lluna se situarà a 0,9° al nord del Cúmul del Pessebre.
– el 28 de novembre, a les 10:49UTC, la Lluna creixent ocultarà Júpiter.
– el 29 de novembre, a les 21:12UTC, la Lluna creixent ocultarà Saturn.
– el 29 de desembre, a les 01:32UTC, la Lluna creixent ocultarà Venus.

Les màximes elongacions de Mercuri seran el 27 de febrer (vespertina, 18°), el 19 d’abril (matutina, 28°), el 23 de juny (vespertina, 25°), el 9 d’agost (matutina, 19°), el 20 d’octubre (vespertina, 25°) i el 28 de novembre (matutina, 20°).

Venus comença l’any com a estel matutí, i assolirà una elongació màxima el 6 de gener amb 47°. Farà la conjunció superior el 14 d’agost, que el durà al cel vespertí, en el que acabarà l’any.

Mart comença l’any com a estel vespertí, en la constel·lació dels Peixos. Després de passar pel Carner, el Bou, els Bessos i el Cranc, farà la conjunció amb el Sol al Lleó (2 de setembre). Acabarà l’any, doncs, com a estel matutí en la constel·lació de la Balança. El 23 de març del 2019, es produirà l’equinocci a Mart que assenyalarà l’inici de la primavera a l’hemisferi nord i de l’autumni a l’hemisferi sud; el 8 d’octubre serà el solstici d’estiu a l’hemisferi nord i el d’hivern a l’hemisferi sud.

L’oposició de Júpiter al Sol tindrà lloc el 10 de juny, moment en el que passarà a ésser un estel vespertí fins a la conjunció el 27 de desembre.

Saturn començarà l’any en conjunció amb el Sol (2 de gener). L’oposició al Sol tindrà lloc el 9 de juliol. La inclinació dels anells durant la conjunció serà de +24°, en una xifra encara elevada, per bé que disminueix des del màxim del 2017.

Urà es trobarà en conjunció amb el Sol el 23 d’abril. L’oposició al Sol tindrà lloc el 28 d’octubre.

Neptú es troba en conjunció amb el Sol el 7 de març, i l’oposició s’esdevindrà el 10 de setembre.

De les pluges d’estels del 2019 indicarem les quadràntides (4 de gener, 02UTC), les lírides (23 d’abril, 00UTC), les eta-aquàrides (5 de maig, 13UTC), les delta-aquàrides (28 de juliol, 15UTC), les perseides (13 d’agost, 07UTC), les oriònides (21 d’octubre, 23UTC), les S-tàurides (6 de novembre, 00UTC), les N-tàurides (12 de novembre, 23UTC), les leònides (18 de novembre, 05UTC), les gemínides (14 de desembre, 18UTC) i les úrsides (23 de desembre, 03UTC).

Pel que fa a la cosmonàutica, destacarem:
– per Cap d’Any, la New Horizons farà una màxima aproximació a (486958) 2014 MU69, que podria dur-la a menys de 3500 km d’aquest petit planeta (d’uns 30 km de diàmetre) del Cinyell de Kuiper.
– entre octubre i novembre hi ha previst el llançament del telescopi espacial CHEOPS, de l’Agència Espacial Europea. Aquesta serà la primera missió de dedicada a la recerca de trànsits exoplanetaris amb l’ús de fotometria d’ultra-alta precisió en estels brillants dels quals ja es coneixen planetes. Es tracta de determinar el diàmetre de diferents planetes neptunians i super-terrestres, per fer una estimació de la densitat.

El nostre 2019 i els altres

El nostre 2019 no és absent de fites. El 20 de maig, per exemple, entraran en vigor les noves definicions de les unitats bàsiques del Sistema Internacional, que fixen la constant de Planck, la càrrega de l’electró, la constant de Boltzmann i la constant d’Avogadro.

En el 2019 també tindrem els primers polsos de neutrons produïts a l’European Spallation Source (ESS). Aquesta instal·lació de Lund es començà a construir el 2013, i no serà completada fins el 2025. La producció de neutrons es basa en l’espal·lació de dianes de tungstè sòlid refredades amb gas heli bombardades amb un corrent de protons procedent d’un accelerador lineal. Els intensos polsos de neutrons que en resultaran seran vehiculats a diferents estacions experimentals. El gros de la recerca d’aquestes estacions experimentals serà la ciència dels materials, amb aplicacions industrials, farmacèutiques, aeroespacials, energètiques, etc.

Entre les cites esportives del 2019, podem esmentar:
– la VIII Copa del Món femenina de futbol associat, que tindrà lloc a França entre el 7 de juny i el 7 de juliol.
– els XVIII Jocs Panamericans, que tindran lloc a Lima entre el 26 de juliol i l’11 d’agost.
– la IX Copa del Món de Rugby-15, que tindrà lloc a Japó entre el 20 de setembre i el 2 de novembre.

En la política internacional, cal destacar que el 29 de març, el Regne Unit de Gran Bretanya i Irlanda del Nord abandonarà la Unió Europea pel mecanisme de l’article 50 del Tractat de la Unió. El Brexit és el primer replegament territorial de rellevància de la història de la Unió Europea (de fet, l’únic antecedent és el de Groenlàndia del 1980), i caldrà veure l’impacte geopolític i geoeconòmic que això tindrà.

El Brexit es produirà en el mateix any que hom preveu la retirada de les darreres unitats de l’Exèrcit de Camp britànic destinades a sòl alemany. Des del 1945, les Forces Armades Britàniques havien tingut presència en territori alemany. Ara queden tan sols elements de la 20ª Brigada d’Infanteria Blindada aquarterats a Padeborn, Sennelager, Bielefeld i Gütesloh. A final del 2019 tan sols romandran uns pocs destacaments amb la intenció de mantindre els llaços entre els exèrcits britànic i alemany.

Són temps on trontollen els projectes d’integració continental. El 2019 era previst que la Unió de Nacions Sud-Americanes (UNASUR) completés el procés d’eliminació d’aranzels sobre tota una sèrie de productes, consolidant un mercat únic per al continent. Però a hores d’ara, la majoria dels membres d’UNASUR han suspès la seva participació en l’organització.

En el calendari electoral podem destacar:
– 16 de febrer: eleccions generals (presidencials i legislatives) a Nigèria.
– 17 d’abril: eleccions generals (presidencials, governatorials i legislatives) a Indonèsia.
– 20 d’abril: eleccions presidencials a Afganistan.
– 23-26 de maig: eleccions al Parlament Europeu.
– 26 de maig: eleccions locals a Espanya.

A partir d’octubre del 2019 entrarà en vigor una prohibició permanent de tota incursió a Uluru, un dels monòlits més grans del món. A banda de raons de seguretat, s’esgrimeixen les creences dels Aṉangu per aquesta decisió

Tampoc no ens podem queixar del nostre 2019. Més fotuda era la vida al Seattle del 2019 de la telesèrie Dark Angel (2000): allò sí que era enginyeria genètica, i no la tímida cirurgia genètica del doctor He que tant ens escandalitza en la nostra línia temporal. No som tampoc vampirs com a Daybreakers (2009).

Si quelcom del film de Ridley Scott, Blade Runner (1982) captura l’esperit del nostre 2019 és potser aquella posició de fragilitat i d’autocompassió que blade runners, replicants i enginyers genètics. Les grans disputes del 2019 són les que giren al voltant de veure qui és el més putejat de tots, i això val pel nostre 2019 que comença i pel Los Angeles del novembre del 2019 del film

Envia un comentari

Bon any 2019, replicants!

Bon any 2019! Sí. És cert que no tenim colònies espacials llevat d’una atrotinada estació orbital a 300 km. És cert que no tenim replicants, i que fins i tot una modesta cirurgia genètica desencadena rius de tinta, però no ens podem queixar pel que fa a les telecomunicacions. A més tenim un aire relativament net, i xamullant l’anglès ens podem fer entendre pels barris de totes les ciutats globals. Així que no ens toca patir en aquest any 2019 pel secretisme de la Tyrell Corporation o pels mètodes expeditius dels “blade runner”, sinó més aviat pel secretisme dels grans gegants de les tecnologies de la comunicació i de la interactivitat, i pels mètodes expeditius dels “trolls” de les xarxes socials. Com que els anys comencen com un full blanc, tan sols tenim anotades algunes efemèrides. Enguany s’escaurà el Centenari de revolucions (espartaquista, consellista, etc.) i de reaccions, commemorant la fundació dels “Fasci di combattimento” i l’entrada d’Adolf Hitler en el Partit Obrer Alemany. També s’escaurà, el 10 d’agost, el Cinquè Centenari de la sortida de l’expedició de Magalhães de Sevilla que havia d’ésser la primera circumnavegació (completada el 1522).

Així veia el pinzell de Nicolas Poussin (1594-1665) en 1627 “La Mort de Germanicus”. Enguany commemorarem el Bimil·lenari d’aquella mort, escaiguda a Antioquia el 10 d’agost del Consolat de M. Iunius Silanus Torquatus i L. Norbanis Balbus. Caius Iulius Caesar Germanicus tenia llavors 32 anys. Nascut com a Nero Claudius Drusus, havia estat introduït a la família Júlia l’any 6 d.C., en ésser adoptat pel seu oncle patern, Tiberi, al seu torn adoptat per l’emperador César August. Després de la mort d’August, Germànic havia estat considerat el successor natural de Tiberi. El nom de Germànic l’havia rebut del seu pare biològic, premiat així per les seves campanyes a Germania, però ell mateix feu mèrits per rebre aquest títol durant diverses campanyes. La seva mort fou atribuïda a una conspiració desencadenada contra els seus intents de reorganitzar les províncies orientals. A banda de la seva carrera militar i política, tingué temps de compondre versos astronòmics com “Aratea

2019: Any Internacional de la Taula Periòdica dels Elements Químics

Logo de l’Any Internacional de la Taula Periòdica dels Elements. El logo representa Mendeleev com a autor de la taula periòdica dels elements químics. Ell mateix ha estat homenatjat a través de l’element 101. En el logo també s’inclouen els quatre elements bàsics de la matèria orgànica: hidrogen (1), carboni (6), nitrogen (7) i oxigen (8).

El 20 de desembre del 2017, l’Assemblea General de Nacions Unides proclamà l’any 2019 com l’Any Internacional de la Taula Periòdica dels Elements Químics. Es tracta de reconèixer la taula periòdica d’elements químics i les seves aplicacions, alhora que hom recorda la tasca de la química en la promoció del desenvolupament sostenibles i les solucions als reptes existents en els àmbits de l’energia, l’educació, l’agricultura i la salut.

La tria del 2019 per celebrar aquesta commemoració s’associà al 150è aniversari de la proposta de sistema periòdica feta per Dmitri Mendeleev. S’uneix també al fet que el 28 de juliol d’enguany es commemora el centenari de la Unió Internacional de Química Pura i Aplicada (IUPAC). La cerimònia inaugural de l’IYPT2019 tindrà lloc a París el 29 de gener.

En el 1869, el sistema periòdic de Mendeleev provava d’oferir una explicació subjacent a la proliferació de descripcions de “nous elements químics”. Aviat la mateixa taula seria utilitzada per hipotetitzar les propietats d’elements químics encara desconeguts. En les dècades posteriors hom entendria la base física de la taula periòdica, de manera que la multiplicitat d’àtoms fou reduïda a un nombre relativament senzill de partícules subatòmiques: protons, neutrons i electrons. D’aquesta forma, la configuració electrònica dels àtoms explicava l’estructuració de la taula periòdica.

En l’actualitat s’han descrit tots els elements químics fins al setè període. Cadascun d’aquests 118 elements ha rebut un nom i un símbol format per una o dues lletres (la primera de les quals en majúscula). D’esquerra a dreta tenim metalls alcalins, metalls alcalino-terris, metalls lantànids, metalls actínids, metalls de transició, metalls de post-transició, metal·loids, no-metalls reactius i gasos nobles. La taula ordena els elements d’acord amb propietats com ara l’energia d’ionització i el radi atòmic.

2019: Any Internacional de les Llengües Indígenes

Per resolució de l’Assemblea General de Nacions Unides (A/RES/71/178) del 19 de desembre del 2016, en el marc de la defensa dels drets dels pobles indígenes, es declarà l’any 2019 com Any Internacional de les Llengües Indígenes.

Es calcula que de les 6700 llengües que es parlen en el món, el 40% es troben en perill de desaparèixer. Moltes d’elles són llengües de pobles indígenes, i el retrocés lingüística implica tota una amenaça a les cultures i sistemes de coneixement dels quals són vehicle. Les llengües indígenes han d’ésser considerades com un recurs estratègic de desenvolupament, construcció de la pau i reconciliació.

2019: Any Internacional de la Moderació

El 8 de desembre del 2017, l’Assemblea General de les Nacions Unides aprovà una resolució en la que es declarava l’any 2019 com l’Any Internacional de la Moderació (A/RES/72/129).

La moderació és considerada un valor important i una estratègia de confrontació a l’extremisme violent, en el tractament del terrorisme i en la promoció del diàleg, el respecte mutu i l’entesa. Així la moderació es considera un reforçament dels tres pilars de les Nacions Unides: 1) pau i seguretat; 2) desenvolupament; i 3) drets humans.

La moderació fomenta la inclusivitat, el respecte a la diversitat, l’entesa, la tolerància i la cooperació entre persones de diferents cultures, religions i creences.

Des d’aquest enfocament, un dels protagonistes de l’Any Internacional de la Moderació serà l’Aliança de Civilitzacions (UNAOC).

L’any 2019 gregorià i els altres

L’any 2019 AD és un any comú (de 365 dies), amb lletra dominal F (car comença en dimarts). Arrencarà en la data juliana de 2458484,5 i en el segon Unix de 1546300800. En el compte llarg maia l’any 2019 arrenca el 13.0.6.2.2. En termes de l’ISO 8601 la primera setmana del 2018 arrenca el dilluns 31 desembre del 2018, i la darrera setmana, la que farà 52, conclourà el diumenge 29 de desembre del 2019. La Lluna començarà l’any cap a quart minvant, amb 23-24 dies d’edat. El Diumenge de Pasqua tindrà lloc el 21 d’abril. Per discrepàncies en el comptatge de l’edat lunar, la Pasqua Juliana s’escaurà el diumenge següent, el 28 d’abril. La Pasqua Jueva (15 de Nisan) començarà el 19 d’abril.

L’any 2019 és l’any 2057 de l’era, l’any 2772 de la fundació de Roma i l’any 3185 de la Discòrdia. L’Any Nou Lunar s’escaurà el 5 de febrer, quan entrarem en el signe del porc de terra (己亥). L’equinocci vernal del 2019 (20 de març) marcarà l’inici de l’any 176 de l’era bahá’í. L’equinocci autumnal del 2019 (23 de setembre) suposarà l’inici de l’any 7528 del món segons el còmput bizantí, l’any 2012 de l’encarnació segons el còmput etíop, l’any 1736 dels màrtirs segons el còmput alexandrí i l’any 228 de la república francesa. La lluna nova de setembre (dia 1) anunciarà els inicis de l’any 5780 del món segons el còmput hebreu i de l’any 1441 de l’hègira. En general, l’any 2019 es correspon a l’any 6769 de la fundació d’Assur, el 4352 de l’era coreana, el 2969 de l’era amazic, el 2563 de l’era budista, el 1953 de l’era javanesa, el 1941 de l’era balinesa, el 1468 de l’era armeniana (ԹՎ ՌՆԿԸ), el 1426 de l’era bengalí, el 1381 de l’era birmana, el 1020 de l’era igbo, el 551 de l’era sikh, el 108 de l’era iutxe i de l’era republicana xinesa. També serà, en principi, l’any 31 i últim de l’era Heisei (平成31年) en el decurs del qual hi haurà l’abdicació de l’actual emperador (prevista pel 30 d’abril).

L’any 2019 astronòmic

El periheli d’enguany, màxim acostament de la Terra al Sol, tindrà lloc el 3 de gener a les 05:20UTC (0,98330 UA). L’afeli, màxim allunyament, es produirà el 4 de juliol a les 22:11UTC (1,017 UA).

Els equinoccis seran el 20 de març a les 21:58UTC i el 23 de setembre a les 07:50UTC. Els solsticis es produiran el 21 de juny a les 15:54UTC i el 22 de desembre a les 04:19UTC.

Tindrem lluna nova el 6 de gener, el 4 de febrer, el 6 de març, el 5 d’abril, el 4 de maig, el 3 de juny, el 2 de juliol, l’1 d’agost, el 30 d’agost, el 28 de setembre, el 28 d’octubre, el 26 de novembre i el 26 de desembre. És a dir, que serà un any de 13 novilunis.

El 2019 serà un any de tres eclipsis solars, cap d’ells visible des de Barcelona:
– el 6 de gener del 2019, amb màxim a les 01:42:38UTC a 67,4°N 153,6°E. Serà un eclipsi parcial visible a l’Àsia Nord-Oriental i al Pacífic Nord. És l’eclipsi 58 dels 70 inclosos en el saros 122.
– el 2 de juliol del 2019, amb màxima a les 19:24:08UTC a 17,4°S 109,0°W (4 minuts i 33 segons de durada). Serà un eclipsi total en el Pacífic Sud, a Xile, en ciutat com La Serena, Coquimbo i La Higuera, i a Argentina, en ciutats com San Juan i Río Cuarto. És l’eclipsi 58 dels 82 inclosos en el saros 127.
– el 26 de desembre del 2019, amb màxima a les 05:18:53UTC a 1,0°N 102,3°E (3 minuts i 40 segons de durada). Serà un eclipsi anul·lar visible en ciutats com Kozhikode, Coimbatore, Jaffna, Trincomalee, Sibolga, Batam, Singapur, Singkawang i Guam. És l’eclipsi 46 dels 71 inclosos en el saros 132.

Tindrem dos eclipsis lunars, tots dos visibles des de Barcelona:
– la matinada del dilluns 21 de gener tindrà lloc un eclipsi lunar total (saros 134). A Barcelona la Lluna entrarà en la penombra a les 03:36CET, quan encara serà a una altitud de 49,6°, i entrarà a l’ombra a les 04:33CET (altitud 39,5°); la totalitat començarà a les 05:41CET (altitud 27,2°) i conclourà a les 06:43CET; la sortida de l’ombra es produirà a les 07:50CET, i quan la lluna creui l’horitzó a les 08:22CET encara ho farà en la penombra.
– la nit del 16 al 17 de juliol tindrà lloc un eclipsi lunar total (saros 139), encara que a Barcelona no passarà d’eclipsi parcial. A Barcelona la lluna sortirà a les 21:16CEST, ja en la penombra; l’eclipsi parcial començarà a les 22:01CEST (altitud 6,1°) i arribarà al màxim a les 23:30 CEST (altitud 17,3°), quan més de la meitat del disc serà cobert; la lluna sortirà de l’ombra a les 00:59CEST i de la penombra a les 02:17CEST.

Enguany també hi haurà un trànsit de Mercuri (l’anterior fou el 2016 i el proper no serà fins el 2032). Serà l’11 de novembre del 2019, i tindrà lloc des de les 12:35UTC a les 18:04UTC. A Barcelona hom el podrà veure, doncs, començar a les 13:35CET; el disc mercurià entrarà completament en el disc solar a les 13:37CET, i arribarà a col·locar-s’hi prop del centre a les 16:19CET; no obstant, com el Sol es posarà a les 17:34CET no veurem la darrera part del trànsit ni la seva conclusió.

Entre les principals conjuncions de l’any 2019 podem citar:
– el 21 de gener, a les 15:32UTC, la Lluna se situarà a 0,6° al sud del Cúmul del Pessebre.
– el 31 de gener, a les 17:36UTC, es produirà l’ocultació de Venus per la Lluna minvant.
– el 2 de febrer, a les 07:18UTC, tindrà l’ocultació de Saturn per la Lluna minvant.
– el 18 de febrer, a les 03:05UTC, la Lluna se situarà a 0,6° al sud del Cúmul del Pessebre.
– l’1 de març, a les 18:40UTC, la Lluna minvant ocultarà Saturn.
– el 17 de març, a les 13:01UTC, la Lluna se situarà a 0,5° al sud del Cúmul del Pessebre.
– el 29 de març, a les 05:11UTC, la Lluna minvant ocultarà Saturn.
– el 13 d’abril, a les 20:12UTC, la Lluna se situarà a 0,2° al sud del Cúmul del Pessebre.
– el 25 d’abril, a les 14:38UTC, la Lluna minvant ocultarà Saturn.
– l’11 de maig, a les 01:35, la Lluna creuarà el Cúmul del Pessebre.
– el 22 de maig, a les 22:25UTC, la Lluna minvant ocultarà Saturn.
– el 7 de juny, a les 07:19UTC, la Lluna se situarà a 0,2° al nord del Cúmul del Pessebre.
– el 18 de juny, a les 18UTC, Mercuri s’acostarà a 0,2° de Mart.
– el 19 de juny, a les 03:58UTC, la Lluna minvant ocultarà Saturn.
– el 4 de juliol, a les 15:02UTC, la Lluna se situarà a 0,2° al nord del Cúmul del Pessebre.
– el 13 de juliol, a les 07:06UTC, Mart se situarà a 0,4° al nord del Cúmul del Pessebre.
– el 16 de juliol, a les 07:27, la Lluna creixent ocultarà Saturn.
– el 12 d’agost, a les 10:05UTC, la Lluna creixent ocultarà Saturn.
– el 28 d’agost, a les 11:31UTC, la Lluna se situarà a 0,2° al nord del Cúmul del Pessebre.
– el 8 de setembre, a les 13:53UTC, la Lluna creixent ocultarà Saturn.
– el 24 de setembre, a les 21:15UTC, la Lluna se situarà a 0,4° al nord del Cúmul del Pessebre.
– el 5 d’octubre, a les 20:48UTC, la Lluna creixent ocultarà Saturn.
– el 22 d’octubre, a les 04:41UTC, la Lluna se situarà a 0,6° al nord del Cúmul del Pessebre.
– el 2 de novembre, a les 07:31UTC, la Lluna creixent ocultarà Saturn.
– el 18 de novembre, a les 10:11UTC, la Lluna se situarà a 0,9° al nord del Cúmul del Pessebre.
– el 28 de novembre, a les 10:49UTC, la Lluna creixent ocultarà Júpiter.
– el 29 de novembre, a les 21:12UTC, la Lluna creixent ocultarà Saturn.
– el 29 de desembre, a les 01:32UTC, la Lluna creixent ocultarà Venus.

Les màximes elongacions de Mercuri seran el 27 de febrer (vespertina, 18°), el 19 d’abril (matutina, 28°), el 23 de juny (vespertina, 25°), el 9 d’agost (matutina, 19°), el 20 d’octubre (vespertina, 25°) i el 28 de novembre (matutina, 20°).

Venus comença l’any com a estel matutí, i assolirà una elongació màxima el 6 de gener amb 47°. Farà la conjunció superior el 14 d’agost, que el durà al cel vespertí, en el que acabarà l’any.

Mart comença l’any com a estel vespertí, en la constel·lació dels Peixos. Després de passar pel Carner, el Bou, els Bessos i el Cranc, farà la conjunció amb el Sol al Lleó (2 de setembre). Acabarà l’any, doncs, com a estel matutí en la constel·lació de la Balança. El 23 de març del 2019, es produirà l’equinocci a Mart que assenyalarà l’inici de la primavera a l’hemisferi nord i de l’autumni a l’hemisferi sud; el 8 d’octubre serà el solstici d’estiu a l’hemisferi nord i el d’hivern a l’hemisferi sud.

L’oposició de Júpiter al Sol tindrà lloc el 10 de juny, moment en el que passarà a ésser un estel vespertí fins a la conjunció el 27 de desembre.

Saturn començarà l’any en conjunció amb el Sol (2 de gener). L’oposició al Sol tindrà lloc el 9 de juliol. La inclinació dels anells durant la conjunció serà de +24°, en una xifra encara elevada, per bé que disminueix des del màxim del 2017.

Urà es trobarà en conjunció amb el Sol el 23 d’abril. L’oposició al Sol tindrà lloc el 28 d’octubre.

Neptú es troba en conjunció amb el Sol el 7 de març, i l’oposició s’esdevindrà el 10 de setembre.

De les pluges d’estels del 2019 indicarem les quadràntides (4 de gener, 02UTC), les lírides (23 d’abril, 00UTC), les eta-aquàrides (5 de maig, 13UTC), les delta-aquàrides (28 de juliol, 15UTC), les perseides (13 d’agost, 07UTC), les oriònides (21 d’octubre, 23UTC), les S-tàurides (6 de novembre, 00UTC), les N-tàurides (12 de novembre, 23UTC), les leònides (18 de novembre, 05UTC), les gemínides (14 de desembre, 18UTC) i les úrsides (23 de desembre, 03UTC).

Pel que fa a la cosmonàutica, destacarem:
– per Cap d’Any, la New Horizons farà una màxima aproximació a (486958) 2014 MU69, que podria dur-la a menys de 3500 km d’aquest petit planeta (d’uns 30 km de diàmetre) del Cinyell de Kuiper.
– entre octubre i novembre hi ha previst el llançament del telescopi espacial CHEOPS, de l’Agència Espacial Europea. Aquesta serà la primera missió de dedicada a la recerca de trànsits exoplanetaris amb l’ús de fotometria d’ultra-alta precisió en estels brillants dels quals ja es coneixen planetes. Es tracta de determinar el diàmetre de diferents planetes neptunians i super-terrestres, per fer una estimació de la densitat.

El nostre 2019 i els altres

El nostre 2019 no és absent de fites. El 20 de maig, per exemple, entraran en vigor les noves definicions de les unitats bàsiques del Sistema Internacional, que fixen la constant de Planck, la càrrega de l’electró, la constant de Boltzmann i la constant d’Avogadro.

En el 2019 també tindrem els primers polsos de neutrons produïts a l’European Spallation Source (ESS). Aquesta instal·lació de Lund es començà a construir el 2013, i no serà completada fins el 2025. La producció de neutrons es basa en l’espal·lació de dianes de tungstè sòlid refredades amb gas heli bombardades amb un corrent de protons procedent d’un accelerador lineal. Els intensos polsos de neutrons que en resultaran seran vehiculats a diferents estacions experimentals. El gros de la recerca d’aquestes estacions experimentals serà la ciència dels materials, amb aplicacions industrials, farmacèutiques, aeroespacials, energètiques, etc.

Entre les cites esportives del 2019, podem esmentar:
– la VIII Copa del Món femenina de futbol associat, que tindrà lloc a França entre el 7 de juny i el 7 de juliol.
– els XVIII Jocs Panamericans, que tindran lloc a Lima entre el 26 de juliol i l’11 d’agost.
– la IX Copa del Món de Rugby-15, que tindrà lloc a Japó entre el 20 de setembre i el 2 de novembre.

En la política internacional, cal destacar que el 29 de març, el Regne Unit de Gran Bretanya i Irlanda del Nord abandonarà la Unió Europea pel mecanisme de l’article 50 del Tractat de la Unió. El Brexit és el primer replegament territorial de rellevància de la història de la Unió Europea (de fet, l’únic antecedent és el de Groenlàndia del 1980), i caldrà veure l’impacte geopolític i geoeconòmic que això tindrà.

El Brexit es produirà en el mateix any que hom preveu la retirada de les darreres unitats de l’Exèrcit de Camp britànic destinades a sòl alemany. Des del 1945, les Forces Armades Britàniques havien tingut presència en territori alemany. Ara queden tan sols elements de la 20ª Brigada d’Infanteria Blindada aquarterats a Padeborn, Sennelager, Bielefeld i Gütesloh. A final del 2019 tan sols romandran uns pocs destacaments amb la intenció de mantindre els llaços entre els exèrcits britànic i alemany.

Són temps on trontollen els projectes d’integració continental. El 2019 era previst que la Unió de Nacions Sud-Americanes (UNASUR) completés el procés d’eliminació d’aranzels sobre tota una sèrie de productes, consolidant un mercat únic per al continent. Però a hores d’ara, la majoria dels membres d’UNASUR han suspès la seva participació en l’organització.

En el calendari electoral podem destacar:
– 16 de febrer: eleccions generals (presidencials i legislatives) a Nigèria.
– 17 d’abril: eleccions generals (presidencials, governatorials i legislatives) a Indonèsia.
– 20 d’abril: eleccions presidencials a Afganistan.
– 23-26 de maig: eleccions al Parlament Europeu.
– 26 de maig: eleccions locals a Espanya.

A partir d’octubre del 2019 entrarà en vigor una prohibició permanent de tota incursió a Uluru, un dels monòlits més grans del món. A banda de raons de seguretat, s’esgrimeixen les creences dels Aṉangu per aquesta decisió

Tampoc no ens podem queixar del nostre 2019. Més fotuda era la vida al Seattle del 2019 de la telesèrie Dark Angel (2000): allò sí que era enginyeria genètica, i no la tímida cirurgia genètica del doctor He que tant ens escandalitza en la nostra línia temporal. No som tampoc vampirs com a Daybreakers (2009).

Si quelcom del film de Ridley Scott, Blade Runner (1982) captura l’esperit del nostre 2019 és potser aquella posició de fragilitat i d’autocompassió que blade runners, replicants i enginyers genètics. Les grans disputes del 2019 són les que giren al voltant de veure qui és el més putejat de tots, i això val pel nostre 2019 que comença i pel Los Angeles del novembre del 2019 del film

Publicat dins de General | Envia un comentari

GAPVAC-101: Un assaig en fase I d’una vaccinació personalitzada per a glioblastomes

El Consorci de Vaccins Activament Personalitzats contra Gliomes (GAPVAC) presenta en una lletra a la revista Nature, de la qual Wolfgang Wick és l’autor corresponsal, els resultats de l’assaig en fase I GAPVAC-101

Tall histològic d’un glioblastoma. Els glioblastomes són uns dels tumors cerebrals més freqüents en adults. Amb un curs molt agressiu, el tractament combina cirurgia, quimioteràpia i radioteràpia. El Consorci GAPVAC va nàixer amb la intenció de desenvolupar un tractament basat en la immunoteràpia, és a dir en l’estimulació del propi sistema immunitari per combatre el tumor

Si enguany el Premi Nobel de Medicina s’ha dedicat a la immunoteràpia oncològica basada en inhibidors de control, GAPVAC va sorgir amb la intenció d’estendre aquesta estratègia al glioblastoma. El problema és que aquesta estratègia funciona en tumors amb una alta càrrega mutacional: el sistema immunitari ha d’actuar-hi a través de neoepitops. En el glioblastoma, de mitjana, hi ha tan sols 30-50 mutacions no-sinònimes. A més, la infiltració de cèl·lules immunitàries en el glioblastoma és limitada. Des de GAPVAC, es vol explotar tot el repertori d’antigens tumorals, és a dir no tan sols els neoepítops sinó també els antígens no-mutats.

L’assaig GAPVAC-101 contempla vaccinacions altament individualitzades. Per a cada pacient se seleccionen antígens presents en el seu tumor cerebral, detectats per anàlisi transcriptòmica i immunopeptidòmica. En l’assaig participaren quinze pacients amb glioblastomes diagnosticats recentment i que presentaven els marcadors (HLA)-A*02:01 o HLA-A*24:02. El vaccí APVAC1 partia d’una llibreria prefabricada d’antígens no-mutats, mentre que el vaccí APVAC2 s’adreçava preferencialment a neoepítops.

Els vaccins empraven com a adjuvants poli-ICLC i GMCSF. L’assaig ha demostrat la seguretat i la forta immunogenicitat dels preparats vaccinals. Si l’APVAC1 era capaç d’estimular en els pacients respostes sostingudes de limfòcits T CD8+ de memòria central, l’APVAC2 induïa predominantment respostes de limfòcits CD4+. Completada la fase I, l’assaig d’aquests vaccins entra ara en la fase on es determinarà la rellevància clínica d’aquests resultats.

Lligams:

Actively personalized vaccination trial for newly diagnosed glioblastoma. Nature (2018)

Publicat dins de 6. La Civilització | Envia un comentari

Les Set Edats

Aquest blog ha patit un canvi destructiu que fa que ja no pugui continuar al ritme que hem seguit durant més de dotze anys. És molt trist que la cultura del retrocés tecnològic hagi arribat a blog.cat

Envia un comentari

Un biomarcador universal del càncer basat en la solvatació i en l’afinitat per l’or de l’ADN

La biologia cel·lular del càncer ha permès durant dècades de recerca d’explicar el procés de transformació tumoral que converteix cèl·lules normals de teixits en cèl·lules canceroses. Malgrat la immensa diversitat de tipus de tumors, hi ha quelcom de comú a tots ells. El grup de recerca de Matt Trau, del Australians Institute for Bioengineering and Nanotechnology de la University of Queensland explora aquesta base comuna per tal de trobar biomarcadors universals del càncer. Trau, juntament amb Abu Ali Ibn Sina i Laura G. Carrascosa, s’ha fixat en la reprogramació epigenètica, particularment pel que fa a la metilació de l’ADN genòmic. La transformació tumoral s’acompanya la majoria de vegades en una alteració d’allò que aquests investigadors anomenen “Methylscape”, és a dir el paisatge de metilacions al llarg del genoma cel·lular. En els genomes tumorals hi ha una metilació agregada en regions reguladores separades per grans passatges intergènics hipometilats. La idea d’Ibn Sina, Carrascosa i Trau és que un canvi tan consistent ha de tindre un impacte en la propietats físico-químiques de l’ADN. S’han fixat particularment en l’efecte dels nivells de metilcitosina i de la seva distribució genòmica en un seguit de propietats físiques i químiques de l’ADN. En un article a Nature Communications expliquen que una alteració en la distribució genòmica de metilcitosina afecten el comportament polimèric de l’ADN, i que això es manifesta en canvis en la solvatació de l’ADN i en l’afinitat de l’ADN per l’or. Així doncs, troben que és possible emprar aquestes dues propietats per diferenciar entre genomes normals i genomes cancerosos. Ibn Sina et al. han desenvolupat a partir d’aquest coneixement assaigs electroquímics o colorimètrics relativament senzills, altament sensibles i selectius, per a la detecció del càncer. Són assaigs ràpids, enllestits en menys de 10 minuts, amb un requeriment mínim de mostra i sense una complexa preparació. Ara, doncs, caldrà demostrar l’aplicabilitat clínica d’aquests assaigs com a eina diagnòstica.

La transformació tumoral implica una alteració en els patrons de metilació de l’ADN. Així, en els genomes tumorals, les metilcitosines es concentren en regions reguladors riques en CpG (la citosina seguida de guanina en la seqüència nucleotídica). Els canvis són prou pronunciats com perquè l’ADN tumoral es diferenciï també en termes de solvatació i, en conseqüència, en l’absorció a superfícies d’or: l’ADN normal tendeix més fàcilment a formar agregats i té una major absorció a l’or en comparació amb l’ADN tumoral

Biomarcador universal del càncer

Aquest projecte fou concebut per Abu Ali Ibn Sina, Laura G. Carrascosa i Matt Trau, del Center for Personalized Nanomedicine, de l’Australian Institute for Bioengineering and Nanotechnology (AIBN) de The University of Queenslands, a Brisbane. Els experiments foren dissenyats per Carrascosa i Ibn Sina, amb l’ajut de Trau. L’extracció d’ADN de mostres de pacients les van dur a terme Darren Korbie (també de l’AIBN) i Ibn Sina. Muhammad J. A. Shiddiky (també de l’AIBN) ajudà en el disseny dels experiments electroquímics. Els experiments els dugueren a terme Ibn Sina, Carrascosa, Ziyu Liang i Andri Wardiana, tots quatre de l’AIBN. Yadveer S. Grewal prengué les imatges de microscopia electrònica de transmissió i de microscopia de força atòmica. Robert A. Gardiner i Hemamali Samaratunga, de la School of Medicine de la University of Queensland forní mostres de càncer de pròstata. Maher K. Gandhi, del Diamantina Institute, de la University of Queensland aportà mostres de limfoma. Rodney J. Scott, de la School of Biomedical Science and Pharmacy, de The University of Newcastle, a Callaghan (Nova Gal·les del Sud) forní mostres de càncer colorectal. Carrascosa i Ibn Sina redactaren l’article amb aportacions dels altres autors.

Aquesta recerca es finança amb el projecte postdoctoral de la UQ de Carrascosa, i el projecte de la National Breast Cancer Foundation of Australia de Trau. Els autors agraeixen a Peter Schmid i Alice Shia per la donació de mostres de l’assaig clínic UK-Forever. En la preparació de mostres participaren els estudiants de màster Ting-Yun Lin, Adithi Dinesh Nambiar i Yefei Liang.

Quan parlem d’epigenètica pensem d’entrada en la metilació d’ADN, és a dir en l’addició d’un grup metil als nucleòtids de citosina (C). La presència de metilcitosines en l’ADN no modifica la seqüència gènica, però sí la interacció de l’ADN amb els proteïnes que participaren en el control i programació genètiques. El patró de metilació de citosina és un dels elements definidor de l’estat epigenètic de la cèl·lula i varia per a cada tipus cel·lular.

En les cèl·lules tumorals hi ha una reprogramació epigenètica. En termes globals es redueix la metilació de l’ADN. Al mateix temps, aquesta metilació augmenta en regions riques en CpG, que habitualment són regions reguladores, com per exemple promotors de gens.

La reprogramació epigenètica de les cèl·lules tumorals i, particularment, els nivells de metilcitosina, constitueixen un àrea d’intensa recerca en la biologia molecular del càncer. Ibn Sina et al., però, s’interessen específicament en com aquesta alteració en la metilació té un impacte en les propietats bàsiques de l’ADN i, fins a quin punt, es poden aprofitar per desenvolupar eines diagnòstiques.

La metilació de l’ADN afecta l’estructura i la flexibilitat de la molècula i, de retruc, la conformació tridimensional. Això s’explica, en part, perquè les metilcitosines són més hidròfobes i tenen un pes molecular superior respecte de les citosines. D’aquesta manera, Ibn Sina et al. han trobat que l’ADN genòmic de cèl·lules normals tendeix més fàcilment a l’agregació en solucions aquoses.

Diferències d’agregació entre epigenomes normals i epigenomes cancerosos

Ibn Sina et al. comparen mostres de pròstata normal i de pròstata cancerosa. A través de la microscopia electrònica de transmissió examinen l’ADN genòmic extret d’aquestes mostres. Mentre l’ADN cancerós recobreix uniformement la superfície de la preparació, l’ADN normal forma grans agregats. L’anàlisi digital de les imatges mostra que la mida típica d’un agregat d’ADN normal és de 8300 nm2, mentre que el d’ADN tumoral és de 1540 nm2.

També comparen les propietats d’agregació de tres epigenomes comparables:
– l’epigenoma de la línia cel·lular tumoral de càncer de mama BT474, que té un nivell de metilació del 43%.
– un epigenoma desmetilat de BT474, a través de l’amplificació hologenòmica.
– un epigenoma M-Jurkat que ha estat metilat al 100% amb una tècnica enzimàtica que garanteix la metilació de tots els llocs CpG.

En aquests tres casos també es manifesta per microscopia electrònica de transmissió que una major metilació global comporta una major agregació. Això s’explicaria per una major hidrofobicitat.

L’absorció de l’ADN a una superfície d’or

Els tres epigenomes esmentats han estat estudiats també pel que fa a l’absorció a substrats ultraplans d’or. En aquest cas, la visualització de la interacció es fa amb microscopia de força atòmica. Ibn Sina et al. comproven que els nivells d’absorció són dependents del nivell de metilació, però d’una manera una mica complexa. Així, l’ADN sense metilar s’absorbeix poc, però també és baixa l’adhesió de l’ADN metilat al 100%; els nivells d’absorció són superiors en la metilació intermèdia.

Els nivells d’absorció de l’ADN a superfícies d’or també són mesurats electroquímicament. En aquest cas, s’utilitzen electrodes d’or, exposats a 5 µL d’ADN purificat (a una concentració de 10 ng/µL). L’absorció es fa en un sistema redox [Fe(CN)6]3-/4-, de manera que el voltatge és superior com menys absorció d’ADN hi hagi en l’electrode.

Per aquest estudi electroquímic, Ibn Sina et al. empren una col·lecció d’ADN genòmics que classifiquen en cinc grups: 1) sense metilació; 2) hipometilats (generats per exposició a 5-azacitidina); 3) de metilació moderada; 4) d’elevada metilació CpG; 5) metilació al 100% en CpG. Troben precisament, que la major absorció es troba en genomes amb nivells de metilació típics de cèl·lules tumorals.

Cap a un mètode simple de detecció de càncer

A partir de l’assaig electroquímic, Ibn Sina et al. exploren diverses línies tumorals de càncer de mama (BT474, MCF7, T47D), pròstata (LNCap), pulmó (H1975) i colorectal (HCT116), així com cèl·lules normals de mama (HMEC) o de pròstata (PrEC). Troben que els genomes de cèl·lules tumorals generen corrents en aquest sistema electroquímic 2,5 vegades superiors al de cèl·lules normals.

La diferència en absorció d’or, explicable per la diferència en el patró de metilació, permet discriminar en un assaig electroquímic entre l’ADN de cèl·lules tumorals i el de cèl·lules normals

Seguidament, Ibn Sina et al. analitzaren amb el seu mètode electroquímic 72 epigenomes procedents de teixits tumorals de pacients (54 de càncer de mama ER+, 8 de pròstata i 10 de limfoma). Els compararen amb 31 epigenomes de teixits normals (19 de mama, 10 de pròstata i 2 de ganglis limfàtics). Obtingueren una precisió del mètode del 89,32%.

La detecció electroquímica d’ADN tumoral en el plasma

Ibn Sina et al. passaren després a comparar mostres de plasma de 100 pacients tumorals (de càncer de mama o colorectal) amb plasma de 45 individus sans. Per a l’anàlisi en tenien prou amb 5 pg d’ADN lliure circulant (cfDNA) extret del plasma. L’assaig es realitzava en 10 minuts. La tècnica els permetia discriminar entre el plasma de pacients tumorals i d’individus sans, amb una precisió del 83,45%.

Un mètode colorimètric discernible a ull nu

Per desenvolupar un mètode colorimètric a partir de les mateixes bases, Ibn Sina et al. utilitzen un sistema d’agregació AuNP. En aquest cas es tracta d’analitzar l’absorció de l’ADN a or col·loidal. La tècnica visualitza pel fet que l’ADN unit a les partícules d’or col·loidal impedeix la formació ulterior d’agregats d’AuNP quan s’hi afegeixen sals. L’agregació d’AuNP és visible com un canvi de color de la solució, que passa del roig al blau.

Aquesta tècnica requereix 50 ng d’ADN purificat, que és incubat amb AuNPs durant 5 minuts. Tot seguit s’hi afegeix una sal. La reacció es monitoritza amb un colorímetre (A658/520).

La tècnica no es tan precisa com l’electroquímica (77,08% de precisió) però és més senzilla. La quantitat de mostra necessària per fer una anàlisi de plasma és la mateixa.

El biomarcador Methylscape

Ibn Sina et al. han estudiat amb detall les bases bioquímiques d’aquest “Methylscape”. Tant el mètode electroquímic (electrode d’or) com el colorimètric (sistema d’or col·loidal) detecten patrons de metilació de l’ADN. La tècnica es pot aplicar tant a ADN extret de biòpsies com de sang perifèrica (mostres de plasma).

Queda endavant, però, tot un desenvolupament fins a aconseguir un mètode d’assaig que sigui clínicament rellevant. Si prospera, el mètode es trobaria en la primera línia diagnòstica davant de símptomes atribuïbles a una neoplàsia amb una anàlisi de sang.

Lligams:

Epigenetically reprogrammed methylation landscape drives the DNA self-assembly and serves as a universal cancer biomarker. Abu Ali Ibn Sina, Laura G. Carrascosa, Ziyu Liang, Yadveer S. Grewal, Andri Wardiana, Muhammad J. A. Shiddiky, Robert A. Gardiner, Hemamali Smaratunga, Maher K. Gandhi, Rodney J. Scott, Darren Korbie, Matt Trau. Nature Communications 9: 4915 (2018).

Publicat dins de 6. La Civilització | Envia un comentari

L’edició del gen CCR5 en embrions humans per protegir front el virus de la immunodeficiència humana

Genètica: Antonio Regalado publicava ahir un article a MIT Technology Review que ha causat sensació en les darreres hores. L’article es titula “científics xinesos creen nadons CRISPR”. Regalado ho fonamenta a través d’un assaig clínic que fou registrat el passat 8 de novembre a la base de dades Chictr amb el número ChiCTR1800019378. Aquest assaig clínic consisteix en “l’avaluació de la seguretat i eficàcia de l’edició gènica amb el gen CCR5 d’embrió humà”. Com diu que el títol es tracta d’avaluar la seguretat i validesa de l’edició gènica del gen CCR5 per conferir immunitat a la infecció pel virus de la immunodeficiència humana (VIH). Aquest virus, com és sabut, infecta limfòcits T CD4+, i pot arribar a desencadenar la síndrome de la immunodeficiència adquirida (SIDA). Per entrar en aquestes cèl·lules el VIH utilitza com una de les molècules d’entrada, a banda del mateix CD4, el CCR5. L’assaig clínic ChiCTR1800019378 no és pas polèmic per això sinó per la tecnologia utilitzada: una edició gènica pel sistema CRISPR que alteraria doncs la línia germinal de l’embrió manipulat. Han saltat totes les alarmes sobre aquest exemple d’eugenèsia. El líder de l’estudi és He Jiankui, de la Universitat Meridional de Ciència i Tecnologia, a Shenzhen. L’estudi, de fet, fou aprovat pel comitè ètic d’aquest centre el 7 de març del 2017. Però en les darreres hores un comunicat de la Universitat diuen que aquest assaig no s’està duent a terme. Som davant d’un clickbait?

Esquema de la interacció entre partícules víriques de l’HIV-1 i cèl·lules CD4+ CCR5+ CXCR4+. La interacció és mediada per aquestes proteïnes de la membrana citoplasmàtica i per les glicoproteïnes gp120 i gp41 de l’embolcall víric. Existeixen variants de CCR5 que bloquen parcialment o total l’entrada del virus i que, per tant, confereixen immunitat a la infecció per HIV. La intenció del grup de He Jiankui és utilitzar la tècnica d’edició genètica CRISPR per generar embrions immunes

L’assaig clínic ChiCTR1800019378

El 8 de novembre del 2018 es va registrar de manera retrospectiva un assaig clínic titulat “Avaluació de la seguretat i validesa de l’edició genètica del gen CCR5 d’immunitat al VIH en embrions humans”. El títol científic de l’assaig és “Avaluació de la seguretat i eficàcia de l’edició gènica amb el gen CCR5 d’embrions humans”. L’assaig fou presentat al Registre Xinès d’Assaigs Clínics per Qin Jinzhou, de la Universitat Meridional de Ciència i Tecnologia, a Nanshan (Shenzhen, Guandong).

D’acord amb les dades del registre, el líder de l’estudi és He Jiankui. L’estudi hauria estat aprovat pel Comitè d’Ètica Mèdica de l’Hospital HarMoniCare Materno-Infantil de Shenzhen el 7 de juliol del 2017. En aquest assaig, doncs, participen la universitat i l’hospital citats. El finançament deriva del Projecte de Lliure Exploració per a la Innovació Científica i Tecnològica de Shenzhen.

El passat mes d’octubre parlàvem del projecte IciStem que estudiava casos d’eradicació del VIH-1 en persones seropositives que, per una leucèmia, s’havien hagut de sotmetre’s a uns transplantament de cèl·lules hematopoiètiques. En un d’aquests casos, a Berlin, el pacient fou transplantat amb cèl·lules procedents d’un donador portador d’una variant del gen CCR5 que confereix resistència a la infecció per VIH-1. Aquest concepte és la base de l’assaig proposat per He. Es tracta d’utilitzar una eina d’edició genètica, el sistema CRISPR, per manipular en embrions humans el gen CCR5 per tal que confereixi resistència a la infecció per HIV.

L’assaig consistiria en una sèrie de casos. Com a criteris d’inclusió es demana:
– parelles casades que visquin a la República Popular Xinesa amb seropositivitat pel VIH, de manera que la dona sigui seronegativa i l’home seropositiu.
– que l’edat dels membres de la parella sigui entre 22 i 38 anys.
– que els marits seropositius siguin clínicament estables, és a dir que gràcies a la farmacoteràpia amb antiretrovirals (que haurien d’haver pres amb regularitat durant els darrers 12 mesos) tingui una càrrega vírica inferior a 75 còpies/ml, un comptatge de CD4+ superior a 250.
– que la parella compleixi clínicament les guies mèdiques per a la teràpia de fecundació in vitro.
– que la parell presti el consentiment plenament informat per entendre el propòsit, riscos i beneficis de l’assaig.
– que tots dos membres de la parell accedeixin a utilitzar contraceptius o mantinguin abstinència al menys durant els dos mesos previs a l’extracció d’òvuls i durant el primer mes després del naixement.

Com a criteris d’exclusió es fixa una càrrega viral superior a 75 abans de la recol·lecció de l’esperma; la presència en un o els dos membres del matrimoni de variació genètica en la seqüència diana a editar amb el sistema CRISPR/Cas9, o qualsevol altra variació que interfereixi amb la tècnica; que durant l’estudi no hi hagi fecundació o gestació després de dos cicles d’estimulació d’oòcits; que la parella hagi fracassat més d’una vegada en intents de fecundació in vitro; contraindicacions en l’ús de fàrmacs durant la gestació; nivells anormals d’hormones sexuals; el fet que un o els dos membres del matrimoni rebin quimioteràpia antitumoral; la participació recent o concomitant en altres assaigs clínics; que un o els dos membres del matrimoni pateixin altres malalties, inclòs alcoholisme o malaltia mental, que pugui influenciar el protocol de l’assaig d’acord amb el criteris dels investigadors o dels clínics.

Aquest estudi es posà un termini de dos anys, entre el 7 de març del 2017 i el 7 març del 2019. En total hi haurien de participar 20 matrimonis, tots ells recrutats al citat hospital de Shenzhen.

L’article d’Antonio Regalado a MIT Technology Review

L’assaig clínic es registrà el 8 de novembre, és a dir ben entrat el període referit de dos anys. Ahir MIT Technology Review publicava un article d’Antonio Regalado. Recordava d’entrada la polèmica desencadenada en el 2015 quan científics xinesos anunciaren que havien assajat l’edició genètica en embrions humans no destinats a la implantació. La qüestió de la manipulació genètica de la línia germinal humana és espinosa i no són poques les jurisdiccions que han prohibit aquesta recerca, per no parlar, ja en termes generals, de l’ús d’embrions humans en experiments destructius.

El sistema CRISPR/Cas9, descobert com a part del sistema immunitari de bacteris front a virus, és la més potent eina d’edició genètica que es coneix. La natura d’aquesta edició genètica ha generat controvèrsia, ja que no tothom la considera una manipulació genètica al mateix nivell que les tècniques més clàssiques de “transgènics”, “knock-out”, “knock-in”, etc.

L’exemple d’edició genètica que proposa el Laboratori de He Jiankui s’adreça al gen CCR5. Variants d’aquest gen confereixen resistència a la infecció per HIV, però també al virus de l’hepatitis C (HCV), al virus de la verola o a la toxina colèrica.

El naixement de les bessones “Lulu” i “Nana”

YouTube Preview Image

En un vídeo publicat hores després de l’article de Regalado, He parlava d’un dels casos inclosos en aquest assaig. Afirmava que la mare, “Grace”, havia donat a llum a dues nenes, “Lulu” i “Nana”. He explicava que en la fecundació in vitro d’aquests embrions s’hi havia introduït un sistema CRISPR/Cas9 per modificar el gen CCR5. El sistema va fer que “Lulu” i “Nana” adquirissin una variant del gen CCR5 que confereix resistència a la infecció per VIH. Hom calcula que aquesta variant ja és present de manera natural en 100 milions de persones.

He explica en el vídeo que abans de la implantació es feren en el laboratori múltiples anàlisis genòmiques i de seqüenciació profunda per tal de garantir que no s’havia produït cap més alteració genètica que la desitjada. Amb aquesta garantia es procedí a la implantació.

Comunicat de la Universitat de Shenzhen

El comunicat de la Universitat Meridional de Ciència i Tecnologia ens diu bàsicament que el doctor He es troba en excedència de tres anys de la plaça universitària des de febrer del 2018. La universitat ha anunciat que emprendrà una acció immediata amb el doctor He per clarificar aquestes informacions.

Segons aquest comunicat, la recerca es realitzà fora del campus, sense cap notificació ni a la Universitat ni al Departament de Biologia. Per a la Universitat, l’ús de la tècnica CRISPR/Cas9 en embrions humans viola l’ètica acadèmica i els codis de conducta.

La rellevància clínica

El risc de transmissió materno-infantil de l’HIV no era pas l’objecte de l’assaig clínic de He, ja que en els casos estudiats l’home era seropositiu la dona era seronegativa. El risc de transmissió materno-infantil en dones no tractades és del 15-45%. Un tractament amb antiretrovirals pot reduir aquest risc a menys de l’1%. La transmissió paterno-infantil és més remota, però no del tot desconeguda (Murugan & Anburajan, 2013, Ezeonwumelu et al., 2018).

El debat, en tot cas, gira sobre l’ús de les tècniques d’edició genètica per modificar de manera permanent i hereditària el genoma humà. Si veiem les reaccions a la premsa del vídeo de He trobarem nombroses referència a l’eugenèsia, als “nens a la carta” i expressions semblants. De posicions hi ha diverses, i si bé la majoritària demana prohibir l’ús de l’edició gènica en la línia germinal humana, d’altres posicions són més laxes, i unes altres qüestionen completament les tècniques de fecundació in vitro.

Lligams

Safety and validity evaluation of HIV immune gene CCR5 gene editing in human embryos. ChiCTR1800019378

– Informe del comitè ètic sobre l’assaig, amb data de 7 de març del 2017.

Chinese scientists are creating CRISPR babies. Antonio Regalado. MIT Technology Review (November 25, 2018).

Publicat dins de 6. La Civilització | Envia un comentari

La 26a Conferència General de Pesos i Mesures aprova les redefinicions de les unitats bàsiques del Sistema Internacional

Avui la Conferència General de Pesos i Mesures (CGPM) ha aprovat per unanimitat la proposta realitzada pel Comitè Internacional de Pesos i Mesures. Aquestes noves definicions entraran en vigor el 20 de maig del 2019.

Diagrama de relacions entre les unitats base del Sistema Internacional i les constants físiques que les defineixen

Les noves definicions

“El segon, simbolitzat s, és la unitat SI de temps. Es defineix en prendre com a valor numèric fixat de la freqüència de cesi ΔνCs, la freqüència de transició hiperfina de l’estat basal no-pertorbat de l’àtom de cesi-133, el de 9.192.631.770 expressat en la unitat Hz (hertz), que és igual al s-1

Fonamentalment, aquesta definició no ha canviat pas amb aquesta revisió, però formalment ara expressa millor el fet que el segon depèn d’un fenomen natural d’escala atòmica, Δν(133Cs)hfs.

“El metre, simbolitzat m, és la unitat SI de longitud. Es defineix en prendre com a valor numèric fixat de la velocitat de la llum en el buit (constant c) 299.792.458 quan s’expressa en m·s-1, on el segon es defineix en termes de la freqüència de cessi ΔνCs“>/p>

De manera semblant, la revisió tan sols prova de remarcar el fet que el metre depèn de la definició del segon a través de la constant c de la velocitat de la llum en el buit. Aquesta constant c és fonamental en explicar les relacions entre les dimensions espacials i la dimensió temporal.

“El quilogram, simbolitzat kg, és la unitat SI de massa. Es defineix en prendre com a valor numèric fixat de la constant de Planck (constant h) 6.62607015·10-34 quan s’expressa en J·s, que és igual a kg·m2·s-1, on el metre i el segon es defineixen en termes de c i de ΔνCs

Aquesta redefinició evita la situació actual en la qual el quilogram era definit a través del seu prototip internacional. D’altra banda, fa que el valor de la constant de Planck quedi fixat en termes d’unitats de SI. La constant de Planck relaciona l’energia d’un fotó amb la seva freqüència, i d’ací que s’expressi en unitats d’energia/temps. La unitat d’energia J (joule) és una unitat derivada del quilogram, del metre i del segon.

“L’amperi, simbolitzat A, és la unitat SI de corrent elèctric. Es defineix en prendre com a valor numèric fixat de la càrrega elemental (constant e) 1.602176634·10-19 quan s’expressa en C, que és igual a A·s, on el segon es defineix en termes de ΔνCs

Aquesta redefinició evita que l’amperi es defineixi a través d’un sistema experimental de caràcter ideal. Ara fa que la càrrega de l’electró adopti un valor fix en termes d’unitats de SI. Per contra, passen a tindre un valor flotant en aquestes unitats tres altres constants: la permeabilitat del buit, la permitivitat del buit i la impedància d’espai lliure.

“El kelvin, simbolitzat K, és la unitat SI de temperatura termodinàmica. Es defineix en prendre com a valor numèric fixat de la constant de Boltzmann (constant k) 1.380649·10-23 quan s’expressa en J·K-1, que és igual a kg·m2·s-2·K-1, on quilogram, metre i segon es defineixen en termes d’h, c i ΔνCs

Aquesta redefinició evita que el kelvin s’hagi de definir a través del triple punt de l’aigua. La nova definició fa que la constant de Boltzmann tingui un valor fix en termes d’unitats de SI. La constant de Boltzmann vincula l’energia cinètica de les partícules a la temperatura.

“El mol, simbolitzat mol, és la unitat SI de quantitat de substància. Un mol conté exactament 6.02214076·1023 partícules elementals. Aquest nombre és el valor numèric fix de la constant d’Avogadro, NA, quan s’expressa en la unitat mol-1 i és anomenada nombre d’Avogadro”.

Aquesta redefinició evita que el mol es fonamenti en la massa atòmica del carboni-12 expressada en quilograms. Converteix en un valor fix la constant d’Avogadro que vincula nombre de partícules amb quantitat de substància. Per contra passa a adoptar un valor flotant la constant de massa molar.

“La candela, simbolitzada cd és la unitat SI d’intensitat lluminosa en una determinada direcció. Es defineix en prendre com a valor numèric fixat de l’eficàcia lluminosa d’una radiació monocromàtica de freqüència 540·1012 Hz (Kcd) 683 quan s’expressa en la unitat lm·W-1, que és igual a cd·sr·W-1 o a cd·sr·kg-1·m-2·s3, on quilogram, mentre i segon es defineixen en termes d’h, c i ΔνCs

Aquesta definició no fa més que remarcar la dependència de la candela respecte del quilogram, del metre i del segon, a través de la relació entre la freqüència electromagnètica i la intensitat lluminosa.

Video de la sessió

Publicat dins de 6. La Civilització | Envia un comentari

Una super-Terra freda al voltant de l’estel de Barnard: GJ699 b

En el 1963, Peter van de Kamp va presentar les dades d’un estudi astromètric de l’estel de Barnard amb les quals hipotetitzava la presència al voltant d’aquest estel d’un o més planetes d’una massa joviana. En el 1973 aquesta proposta era descartada amb mesures més precises de George Gatewood i Heinrich Eichhorn. Haurien de passar dues dècades més per a la detecció contrastada d’exoplanetes en altres estels. Des de llavors, hom ha anat investigant l’estel de Barnard a la recerca de planetes. Demà a la revista Nature apareixerà un article d’un equip internacional d’astrònoms on presenten dades d’una “super-Terra freda” orbitant l’estel de Barnard en la “línia de neu”. El primer autor de l’article és Ignasi Ribas, de l’Institut de Ciències de l’Espai de Bellaterra, i el darrer és Guillem Anglada-Escudé.

Un estel emblemàtic

L’Estel de Barnard té una magnitud aparent de +12,497. És lògic, doncs, que no fos catalogat dins de la constel·lació de Serpentari fins l’adveniment de l’era astrofotogràfica, el 1888. De totes maneres rebé aquest nom propi arran dels estudis d’E. E. Barnard sobre moviment propi dels estels (Barnard, 1916). Amb un moviment propi de 10,3 arcsegons en el component tangencial, l’anomenat Estel de Barnard superava i supera tots els registres en aquest sentit. Aquest moviment propi s’explica perquè és un estel relativament proper al nostre Sistema Solar, a una distància de 1,8 parsecs. Es tracta d’un estel solitari, i en aquest sentit és l’estel solitari més proper al Sol (ja que Alfa Centauri és un sistema estel·lar triple). L’Estel de Barnard és un dels nans vermells més intensament estudiats. També és un dels nans vermells menys actius magnèticament.

El fort moviment propi i la poca activitat magnètica el van fer interessant, ja en els anys 1930, en la investigació exoplanetològica. Des de llavors hom ha explorat sense èxit la presència de planetes al voltant d’aquest estel amb mesures de la velocitat radial, l’astrometria i fins i tot amb astrofotografies.

Ribas et al. han combinat nombroses mesures d’alta precisió de velocitat radial fetes durant els darrers 20 anys, amb les quals han identificat la presència d’un senyal periòdic de 233 dies. Ho atribueixen a un planeta, atribució que reforcen amb dades fotomètriques i espectroscòpiques. Aquest planeta hauria d’ésser una super-Terra, amb una massa, com a mínim, 3,2 vegades superior a la del nostre planeta. El seu període orbital de 233 dies el situa en l’anomenada “línia de neu” de l’Estel de Barnard. Calculen que la separació angular màxima que ofereix aquesta òrbita seria de 0,22 arcsegons, de manera que podria ser accessible a la detecció telescòpica directa o a l’observació astromètrica amb futurs telescopis orbitals. De moment, però, les dades que tenim són de velocitat radial, fotometria i espectroscopia.

La detecció de GJ699b

El punt de partida de Ribas et al. fou l’anàlisi de les velocitats radials obtingudes de l’Estel de Barnard fins el 2015. En aquests arxius era possible observar, com a mínim, un senyal amb un període de 230 dies. Es tractava, però, d’un senyal de baixa amplitud, que requeria observacions precises. Així doncs, Ribas et al. iniciaren una campanya intensiva de monitorització de l’estel amb l’espectròmetre CARMENES: cada nit del 2016 i 2017 que fou possible s’obtingueren mesures precises de velocitat radial. Paral·lelament, es feien observacions amb els instruments ESO/HARPS i HARPS-N.

La combinació de les dades d’arxiu i les de nova adquisició abastà un total de 771 nits, en les quals la precisió de velocitat radial era de 0,9-1,8 m·s-1. Aquestes 771 nits es distribuïen en un període de 20 anys, procedents de set instal·lacions diferents. Amb aquesta combinació de dades el període de 233 dies assolia una significativa estatística alta, amb una probabilitat de falsa alarma de 10-15.

En la velocitat radial d’un estel no actuen únicament planetes orbitants, sinó també factors intrínsecs al propi estel. Les dades fotomètriques indiquen que l’Estel de Barnard té un període de rotació de 130 dies (mentre que les dades espectroscòpiques valoren en 148,6 dies). Ribas et al. analitzen dades fotomètriques i espectroscòpiques (fluxos cromosfèrics de Hα i Ca II H&K) per estudiar els períodes corresponents d’activitat estel·lar. Les sèries fotomètriques indiquen un senyal periòdic de 144 dies, les sèries de Hα un de 133 dies, i els índexs cromosfèrics de Ca II un de 143. Ribas et al. atribueixen aquests períodes a una rotació estel·lar de 140 dies. Es tracta d’un període prou separat com per no confondre’s amb el període de 230 dies.

Que el període de 233 dies sigui de natura planetària seria refermat pel fet que, acumulant observacions, es guanya monotònicament en significància estatística. Això és més propi d’una òrbita kepleriana que no pas d’una activitat estel·lar que tindria un caràcter més aleatori.

Una super-Terra freda

Ribas et al. estimen que el responsable del període de 233 dies en la velocitat radial de l’Estel de Barnard seria un planeta amb una massa 3,2 vegades superior a la de la Terra. Aquest planeta seguira una òrbita de baixa excentricitat, amb una distància mitjana de l’estel de 0,4 unitats astronòmiques.

Les dades de Ribas et al. són també prou precises com per refermar la idea que l’Estel de Barnard no tindria cap planeta d’una massa similar o superior a la de la Terra en òrbites inferiors. Això explicaria la manca de deteccions en prospeccions anteriors.

La confirmació del planeta per una detecció astromètrica semblaria a l’abast per missions com Gaia o HST, que tenen una capacitat de resolució de 0,03 miliarcsegons. Segons quina sigui la inclinació del pla orbital de GJ669b aquesta resolució seria suficient com per detectar i estudiar el planeta de manera directa

Publicat dins de 1. L'Univers | Envia un comentari

L’impacte de les pluges sobre la microbiota de la zona hiperàrida del Desert d’Atacama

Ecologia microbiana: El Desert d’Atacama és l’indret més àrid de la terra. Per minses que puguin semblar en termes absoluts, els episodis de pluja registrats en els darrers tres anys a la zona central d’Atacama no tenen precedents. Com a resultat d’aquestes pluges s’han formats llacs hipersalins que, en alguns casos, han perdurat durant mesos. Aquest ambient inusitat impulsà el grup de recerca d’Armando Javier Azúa Bustos i de Alberto G. Fairén, del Centro de Astrobiología del CSIC-INTA, de Madrid, a fer-hi un seguiment de les comunitats microbianes, com si es tractés d’un model de Mart a la Terra. En un article a Scientific Reports ofereixen una anàlisi sistemàtica de l’evolució de les llacunes formades especialment enfocat a les comunitats microbianes locals. Cal recordar que algunes d’aquestes zones haurien estat completament àrides en els darrers milions d’anys. L’entrada sobtada i massiva d’aigua, segons mostren Azua-Bustos et al. perjudicà la majoria d’espècies microbianes que viuen en la superfície del sòl. Es tracta de microorganismes xeròfils, adaptats a sobreviure amb quantitats molt magres d’aigua, i que pogueren resistir el xoc osmòtic provocat per la pluja. Així doncs, en aquestes llacunes hipersalines tan sols un nombre reduït de bacteris hi són metabòlicament actius. Azua-Bustos et al. descriuen entre aquests bacteris, una espècie prèviament desconeguda, Halomonas yungayensis. És interessant, doncs, constatar que la pluja sobtada i voluminosa té un efecte depressor en la diversitat de les comunitats microbianes de sòls de regions hiperàrides. Azua-Bustos et al. utilitzen aquest estudi per reflexionar sobre les condicions de Mart, “un planeta hiperàrid que experimentà inundacions catastròfiques en temps antics“.

El 7 de juny del 2017 va ploure a la zona de Yungay. Azua-Bustos et al. visitaren el 8 de juliol del 2017 (A). L’11 de novembre del 2017 hi feren una altra visita als llacs grans (B), mitjà (C) i petit (D)

Yungay, Atacama

Aquesta recerca fou concebuda per Azua-Bustos i per Fairén, que foren els qui dirigiren l’estudi i redactaren l’article. Cal recordar que Azua-Bustos també és membre del Instituto de Ciencias Biomédicas de la Facultad de Ciencias de la Salud de la Universidad Autónoma de Chile. L’estudi in situ i la recollida de mostres la va fer Carlos González-Silva, de la Facultad de Ciencias de la Universidad de Tarapacá, de Arica. La preparació de mostres i l’obtenció de electromicrografies de transmissió anaren a càrrec de Jacek Wierzchos i Carmen Ascaso, del Museo Nacional de Ciencias Naturales de Madrid. El cultiu de les mostres i l’aïllament de microorganismes els feren Azua-Bustos i Laura García Descalzo, que també és membre del Departamento de Planetología y Habitabilidad del Centro de Astrobiología. Azua-Bustos realitzà el genotipat d’elements repetitius ERIC1, l’amplificació del gen del ARNr 16S, i l’anàlisi filogenètica. Les anàlisis de de seqüenciació les realitzà Miguel Ángel Fernández Martínez, el Departamento de Evolución Molecular del Centro de Astrobiología. L’extracció de lípids, fraccionament i anàlisi per cromatografia de gasos i espectrometria de masses la feren Daniel Carrizo i Laura Sánchez García, del Departamento de Evolución Molecular. També del mateix Departament és Miriam García Villadangos, que realitzà l’anàlisi de cromatografia iònica. María Paz Martín Redondo, del Departamento de Planetología y Habitabilidad, realitzà l’espectrometria de masses de plasma acoblat inductivament. Víctor Parro, del Departamento de Evolución Molecular, féu el serotipat per microarray. Mª Teresa Fernández Sampedro, del Departamento de Planetología y Habitabilidad, realitzà l’anàlisi de difracció de raigs X.

Aquesta recerca es va fer en el marc del projecte “icyMARS”, finançant pel Consell Europeu de Recerca. Fairén i Pardo també reben finançament del Ministeri d’Educació d’Espanya i del programa FEDER pel seu projecte de detecció de biomolècules en l’exploració planetària. També tenen paraules d’agraïment per a Virginia Souza-Egipsy en la interpretació de les electrografies.

El Desert d’Atacama, en el nord de Xile, situat entre la Serralada dels Andes a l’est, i la Serralada Litoral a l’oest, ocupa uns 105.000 km2. En la zona central trobem un clima hiperàrid, que ha suportat condicions d’aridesa durant els darrers 150 milions d’anys, i condicions d’hiperaridesa durant els darrers 15 milions. En aquesta zona la precipitació anual mitjana es troba per sota dels 4 mm/m2. No és estrany que hom hagi proposat la regió de Yungay, dins d’aquesta zona hiperàrida, com un bon model per als estudis de Mart.

L’eixutesa extrema, l’elevat contingut salí del sòl (particularment enriquit en nitrats, sulfats i perclorats) i l’extremada pobresa en matèria orgànica fan de la regió de Yungay un indret força inhòspit. Tanmateix, és un indret amb vida microbiana. Bacteris, arqueons i eucarionts de Yungay comparteixen una elevada tolerància a la sequedat, a l’elevada salinitat i a la radiació ultraviolada.

Imatges del Desert d’Atacama durant el primer terç del mes de juny del 2017. L’aridesa de la regió s’explica pel fet que la Serralada Litoral constitueix una barrera per als núvols que arriben del Pacífic: no debades, el vessant marítim de la Serralada Litoral és un dels indrets amb més precipitacions anuals del món. Entre el 5 i el 7 de juny del 2017, núvols de pluja creuaren no obstant la serra i precipitaren a Atacama, bé en forma de pluja, en les zones baixes, o de neu

Si bé en la perifèria del Desert d’Atacama no són del tot infreqüents les precipitacions de pluja o de neu durant “l’hivern altiplànic”, entre el desembre i el març, degut a corrents d’aire humit de llevant que creuen els Andes, la zona central d’Atacama no és exposada a aquestes situacions. En els darrers quatre anys, no obstant s’han registrat tres pluges remarcables per l’entrada de vents de ponents:
– la del 25 de març del 2015.
– la del 9 d’agost del 2015.
– la del 7 de juny del 2017.

Aquests tres episodis de pluges, juntament amb altres de menor quantia, han fet que la precipitació anual per al període 2015-2017 hagi estat de fins a 40 mm/m2, és a dir deu vegades superior de la mitjana climàtica. D’acord amb els registres paleometeorològics, aquesta situació no té precedents en els darrers 500 anys.

Com a resultat d’aquests episodis de pluja es formaren llacunes a la regió de Yungay per primera vegada en la història documentada. El novembre del 2017 encara sobrevivien tres llacunes a la regió de Yungay cinc mesos després de la pluja del 7 de juny. Aquestes tres llacunes foren l’objecte de l’estudi d’Azua-Bustos et al.

El mostreig de tres llacunes hipersalines

L’11 de novembre del 2017 es procedí una presa de mostres en tres llacunes de la regió hiperàrida de Yungay. Les mostres les prengué González-Silva amb guants estèrils, abocant-les a tubs falcon de 50 ml.

La cromatografia iònica permeté la quantificació d’anions d’aquestes mostres. Per espectrometria de masses ICP-MS es feren determinacions d’elements (Mn, Cu, Co, Cd, Ba, Na, Mg, K, Ca, Fe, Ni, Zn, As).

La composició mineralògica de les aigües fou estudiada per difracció de raigs X (XRD).

El contingut lipídic de les mostres fou analitzat per cromatografia gasos acoblada a espectrometria de masses (GC-MS), diferenciant entre les fraccions apolar, acídica i polar.

Per a l’extracció d’ADN, les mostres eren centrifugades i als pellets resultants se’ls aplicava el DNeasy PowerSoil Kit.

Dels extractes d’ADN es feien amplificacions de la regió V3-V4 del gen rDNA 16S amb els encebadors 5′-ACACTGACGACATGGTTCTACACCTACGGGNGGCWGCAG-3′ i 5′-TACGGTAGCAGAGACTTGGTCTGACTACHVGGGTATCTAATCC-3′ en els primers cicles. Els amplicons obtinguts eren validats i quantificats, i seguidament seqüenciats.

Alíquotes d’1 mL de les mostres foren incubades aeròbicament a 25°C en agar amb diferents medis, i se’n seguí el creixement durant 2 setmanes. De les colònies obtingudes es féu una extracció d’ADN i una seqüenciació del gen rDNA 16S.

Extractes d’ADN de les colònies obtingudes també foren analitzats amb encebadors ERIC (5′AAGTAAGTGACTGGGGTGAGCG3′ i 5′-ATGTAAGCTCCTGGGGATTCAC-3′), que amplifiquen seqüències repetitives intergèniques de consens entre enterobacteris. Si el gen rDNA 16S permet una classificació taxonòmica a l’engròs, la tècnica de PCR-ERIC, sense necessitat de seqüenciació, ajuda a afinar a nivell d’espècie.

Mostres dels cultius obtinguts de la llacuna gran i de la petita foren destinades a la microscòpia electrònica de transmissió. Com a tècnica de tinció s’utilitzà la negativa de fosfotungstat de sodi. Les electrografies permetien caracteritzar els diferents morfotips de cada cultiu bacterià: mida, forma, presència o absència de flagels i la seu nombre i inserció, presència o absència de cossos intracel·lulars electrodensos.

Y. Blanco forní Parro de LDChip. Es tracta d’un xip que conté 200 anticossos que reaccionen davant de lisats crus de bacteris i arqueons, així com de proteïnes i pèptids implicats en funcions metabòliques (fixació de nitrogen, fixació de carboni, metabolisme del ferro, oxidació del sofre, metanogènesi, etc.). Així les mostres d’aigua foren processades i analitzades en aquests microarrays.

Les tres llacunes hipersalines de Yungay

D’acord amb les dades de cromatografia de bescavi iònic, de ICP-MS i de XRD les aigües de les tres llacunes estudiades presenten unes característiques físico-químiques que es corresponen a la composició salina i la variabilitat dels sòls que les envolten. És cert, però, que les tres llacunes difereixen en els nivells de calci i de sulfat.

En els sòls d’aquesta zona s’havien reportat un mínim de 16 espècies microbianes endolítiques i hipolítiques. Les llacunes hipersalines resultats de les pluges de juny no mostraven pas aquesta diversitat microbiana. A través de les anàlisis genètiques, Azua-Bustos et al. no han pogut trobar rastre d’espècies arqueanes o eucariòtiques. Les úniques seqüències detectades en les llacunes són bacterianes, i més del 60% d’aquestes seqüències pertanyen a tan sols quatre unitats taxonòmiques operatives: Halomonas, Marinimicrobium, Marinobacter i Acinetobacter. Totes quatre unitats pertanyen a la classe dels gammaproteobacteris, i suposen la pràctica totalitat dels bacteris presents.

La biodiversitat de les llacunes és inferior com més elevada és la salinitat. En aquest sentit, la tolerància a la salinitat de Marinimicrobium i Marinobacter és més elevada que la d’Halomonas i Acinetobacter.

L’observació de les mostres d’aigua de les llacunes amb microscòpia de fluorescència mostrà l’absència d’espècies fotosintètiques (cianobacteris i microalgues). Aquesta absència fou confirmada per la microscòpia de camp brillant, a més de les per les proves genètiques.

Les electrografies de transmissió sobre les mostres d’aigua mostraven la presència de tan sols quatre morfotips diferents. Un d’aquests morfotips és una cèl·lula amb un sol flagel lateral, que es podria correspondre a Halomonas. Un altre és d’una cèl·lula amb un sol flagel polar, que es podria correspondre a Marinimicrobium i a Marinobacter. Un tercer morfotip mostra, a més d’aquest sol flagel polar, dos pols foscos distintius, tal com passa en Marinobacter.

Les electromicrografies de transmissió de mostres de les llacunes indicaven la presència de quatre morfotips: A, B, C i D (A). Entre aquests morfotips trobem cèl·lules amb un sol flagel lateral i d’altres amb un sol flagel polar (B). Les seqüències genètiques fan que Azua-Bustos et al. descriguin l’espècie “Halomonas yungayensis”, de la qual fan l’anàlisi filogenètica (C)

De les mostres d’aigua tan sols aconsegueixen el cultiu de microorganismes quan empren un medi de cultiu “marí”, i això tan sols en mostres de les llacunes gran i mitjana. A partir d’un d’aquests cultius, d’acord amb les dades d’ERIC i de 16S, descriuen una espècie nova, que denominen Halomonas yungayensis. Aquesta espècie, com altres Halomonas, creix en plaques d’agar formant colònies de color blanc-groc, que es tornen un bru lleuger amb el temps.

En la llacuna petita, la més salina, hom detecta la presència per anàlisi genètica de Marinimicrobium i Marinobacter, però no han aconseguit cultivar-les.

Les anàlisis lipídiques de les mostres d’aigua de les llacunes mostren concentracions extremadament baixes. No s’hi detecten ni àcids n-carboxílics insaturats, ni n-alcanols, ni tampoc isoprenoids (pristà, fità, etc.), ni esterols. L’absència de fità ve a confirmar la completa absència d’organismes clorofíl·lics. L’absència d’esterols indica la completa absència de cèl·lules eucariòtiques. És en les llacunes més grans on trobem uns nivells més elevats d’alguns àcids n-carboxílics, com ara el 16-metil-heptadecanoic, que són producte de l’activitat metabòlica de bacteris.

Les quatre unitats taxonòmiques i morfotípiques trobades en les llacunes hipersalines analitzades es corresponen, d’acord amb les dades genètiques, amb espècies que habitaven prèviament els sòls hiperàrids d’aquest indret.

Les dades del LDCChip indiquen que la formació de la llacunes produïa una severa disrupció dels ecosistemes dels sòls preexistents. En efecte, a través del xip hom detecta biomarcadors associats a alfaproteobacteris, betaproteobacteris, gammaproteobacteris, firmicutes, actinobacteris, bacteroidetes, cianobacteris, etc. El xip indica la presència de proteïnes relacionades amb la fixació de nitrogen, de metabolisme de ferro, d’emmagatzematge de carboni i de components d’halovirus. D’alguna manera aquesta detecció immunològica, combinada amb l’absència de senyals detectables per microscòpia o per anàlisi genètica, és indicativa del naufragi patit per aquesta comunitat microbiana, de la qual tan sols haurien sobreviscut quatre grups de gammaproteobacteris. El cas més il·lustratiu potser és el dels cianobacteris (com halotecis o clorococcals), que són presents en el sòl hiperàrid d’Atacama, i que en canvi tan sols es detecten en forma de traça, ja sense integritat ni activitat metabòlica, en les llacunes formades arran de la pluja de juny del 2017.

Xeròfils ofegats

En les zones de Yungay inundades cinc mesos després de la pluja del juny del 2017 havien desaparegut, doncs, entre el 75% i el 87% de les espècies detectades originàriament en els sòls hiperàrids. En la llacuna més petita i més salina, amb una concentració prou elevada de sulfats com per tindre una tonalitat verdosa, únicament hi sobrevivien dues espècies de bacteris.

Segons Azua-Bustos et al. una entrada massiva i sobtada d’aigua en regions que han romàs extremadament àrides durant milions d’anys provoca una disrupció de la majoria de comunitats microbianes. Cal pensar que l’exposició sobtada a grans quantitats d’aigua per espècies adaptades a sobreviure amb molt poca quantitat d’aigua produeix un xoc osmòtic letal. Per corroborar aquesta hipòtesi, caldrà un estudi més perllongat en el temps, a mesura que les llacunes formades vagin recedint. També cadria incloure en l’estudi mostres de sòl més fondes, més enllà dels 15 cm de fondària, per saber si foren afectats per la presència de la llacuna durant un temps més o menys perllongat.

En aquest sentit, doncs, el grup d’Azua-Bustos i Fairén treballa en mostres de la superfície i de la subsuperfície de sòls que han estat bé humitejats o submergits. També fan el seguiment de la diversitat microbiana en les llacunes a mesura que s’evaporen.

Què ens pot ensenyar Yungay sobre Mart?

A més de fer part del Centro de Astrobiología de Madrid, Azua-Bustos és membre de l’Instituto de Ciencias Biomédicas de la Universidad Autónoma de Chile, i Fairén és membre del Department of Astronomy de la Cornell University. Atacama els atreu per la informació que el pugui donar sobre qüestions fonamentals de la biologia i, en particular, sobre la hipotètica biologia marciana.

Yungay es troba en el “nucli d’Atacama”. Aquest nucli no es defineix tant per les dades meteorològiques com per la distribució dels dipòsits de nitrats. Els dipòsits de nitrats de la zona tenen una antiguitat de 13 milions d’anys. El dipòsit de nitrats proper a Yungay fou explotat des de les darreries del segle XIX. Aquests dipòsits són testimonis d’una activitat fluvial pretèrita, que arrossegà nitrats cap al fons de les valls. Segons Azua-Bustos et al. els dipòsits també s’han d’haver alimentat a partir de nitrats atmosfèrics, aportats per inundacions ben espaiades, i acumulats per la pràctica absència de microorganismes denitrificadors.

Dipòsits de nitrats semblants s’han detectats en sediments marcians. Es desconeix, però, si a Mart es desenvolupà un cicle de nitrogen, amb components abiòtics o biòtics. Segons Azua-Bustos et al., els dipòsits de nitrats de Yungay mostren la possibilitat que a Mart es formessin aquests dipòsits a través d’un procés d’extrema eixutesa puntuat amb inundacions extremes que arrosseguessin els nitrats cap a les fondalades, on l’evaporació implacable concentrava els nitrats sense que processos abiòtics o biòtics els consumissin.

El Mart primigeni devia comptar, fa entre 4,5 i 3,5 milers de milions d’anys, amb una hidrosfera superficial activa. Aquesta hidrosfera superficial, després, s’anà dessecant fins arribar a la situació actual hiperàrida del planeta. En la transició l’evaporació secular era contrarestada episòdicament per enormes inundacions, testimoni de les quals són els canals més voluminosos que es coneixen de tot el Sistema Solar. Fins ara, hom veia aquestes inundacions com moments favorables per als hipotètics ecosistemes moribunds de Mart, però Azua-Bustos et al. pensen més aviat que aquestes inundacions tingueren un efecte detrimental sobre una hipotètica microbiota marciana adaptada a la hiperaridesa.

Amb aquest raonament, Azua-Bustos et al. arriben a qüestionar els resultats dels experiments biològics realitzats per les sondes Viking en el 1976. Els experiments de bescanvi de gas i d’alliberament de marcatge començaven a fet incubant mostres de sòl marcià amb diverses solucions aquoses. Aquesta aigua excessiva hauria suposat un estrès osmòtic insuportable per a les hipotètiques cèl·lules marcianes. A més, el caràcter altament oxidant de la regolita marciana, exposada a aquesta aigua, hauria destruït les molècules orgàniques presents, i d’ací l’absència de detecció per part de la Viking.

Aprendre, doncs, de les comunitats microbianes ultraxeròfiles d’Atacama ens pot ajudar per dissenyar experiments més robustos i menys ambigus per a la detecció dels hipotètics microorganismes que podria haver a la superfície o a la subsuperfície del Mart actual.

Lligams:

Unprecedented rains decimate surface microbial communities in the hyperarid core of the Atacama Desert. A. Azua-Bustos, A. G. Fairén, C. González-Silva, C. Ascaso, D. Carrizo, M. Á. Fernández-Martínez, M. Fernández-Sampedro, L. García-Descalzo, M. García-Villadangos, M. P. Martin-Redondo, L. Sánchez-García, J. Wierzchos & V. Parro. Scientific Reports 8: 16706 (2018)

Publicat dins de 3. La Vida | Envia un comentari

Una anàlisi sistemàtica del GBDS-2017 sobre l’evolució de la fertilitat des del 1950

Lancet publicava ahir un article del grup de col·laboradors en població i fertilitat de l’Estudi sobre la Càrrega Global de Malalties del 2017 (GBDStudy2017). Aquest estudi ens presenta estimacions de fertilitat i de població per cada sexe amb mètodes estandarditzats i replicables per a 195 nacions i territoris i per cada any entre el 1950 i el 2017. Les estimacions combinen dades de fertilitat, mortalitat, població i migració. D’això en deriven taxes de fertilitat específiques d’edat, i a partir d’elles les taxes de fertilitat total. Globalment, la taxa de fertilitat total disminuí entre el 1950 i el 2017 en un 49%, passant de 4,7 parts de nadons vius a 2,4. La taxa de fertilitat específica de les dones més joves (10-19 anys) es reduí del 3,7% al 2,2%. Aquesta reducció de la fertilitat no ha anat acompanyada d’una reducció de la població global que, des del 1985, creix a un ritme anual de 83,8 milions de persones. Així doncs, la població global ha passat del 2.600 milions del 1950 a 7.600 milions en el 2017 (un augment de gairebé el 200%). Aquest augment demogràfic s’ha concentrat al Sud d’Àsia i a l’Àfrica Sud-Sahariana. La taxa de creixement anual assolí un pic del 2,0% entre el 1950 i el 1964, per romandre estable fins el 1970, quan començà a decrèixer fins al nivell actual de l’1,1%. Aquest decreixement no és uniforme, i de fet encara no ha començat a l’Àfrica Sud-Sahariana (taxa de creixement del 2,7%). L’edat mitjana global, que era de 26,6 anys en el 1950, és ara de 32,1 anys, de manera que la població en edat de treballar (15-64 anys) ha pujat del 59,9% del 1950 al 65,3% actual. Si ho mirem per països la taxa de fertilitat total més baixa es troba a Xipre (1,0) i la més alta a Níger (7,1). Entre el 2010 i el 2017, 33 països han experimentat una davallada de la població, sobretot a Europa.

Un estudi finançat per la Bill & Melinda Gates Foundation

La finalitat d’aquest estudi és oferir dades demogràfiques el més acurades possibles. En les piràmides d’edat, les variables demogràfiques són estructurades en grups d’edat i en els dos sexes. Ofereixen globalment una estimació de la mida de la població, de l’edat i de la composició. Des del 1951, la Divisió de Població del Departament d’Afers Econòmics i Socials de Nacions Unides (UNPOP) ofereixen estimacions descentralitzades sobre fertilitat, mortalitat, migració i població. Altres organitzacions que forneixen dades globals o regionals són la Divisió Internacional de l’Oficina del Cens dels Estats Units, l’Oficina de Referència de Població, el Banc Mundial, el Centre Wittgenstein o la Fundació Gapminder. Existeixen discrepàncies entre les estimacions d’algunes d’aquestes organitzacions i d’agències nacionals.

L’equació d’equilibri demogràfic

En l’equació:
N(T) = N(0) + B(0,T) – D(0,T) + G(0,T)
N(T) és la població en el temps T, i N(0) és la població en el moment inicial. B(0,T) són els naixements escaiguts en període, D(0,T) les morts que s’hi han produït i G(0,T) és el saldo migratori.

Aquestes dades bàsiques han d’ésser complementades amb informació sobre l’estructura demogràfica: sex ratio, dades específiques d’edat, etc.

Unitats geogràfiques i cronològiques

El GBDStudy contempla 195 països i territoris, agrupats en 21 regions i 7 super-regions. La unitat cronològica és l’any natural.

Les dades de fertilitat

La base d’aquestes dades són els sistemes de registre vital, que inclouen dades de cada dona quant als fills que han tingut i a quina edat els ha tingut.

Les dades de població

En les dades de població s’han inclòs 1233 censos i 26 registres de població. Els censos en general ofereixen subestimacions de la població real.

Lligams:

Population and fertility by age and sex for 195 countries and territories, 1950-2017: a systematic analysis for the Global Burden of Disease Study 2017. GBD 2017 Population and Fertility Collaborators. Lancet 392: 1995-2051 (2018).

Publicat dins de 6. La Civilització | Envia un comentari